ID: 944893973

View in Genome Browser
Species Human (GRCh38)
Location 2:204145326-204145348
Sequence GCCTCATCCTCACCTGCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944893973_944893977 -3 Left 944893973 2:204145326-204145348 CCAAAAGCAGGTGAGGATGAGGC No data
Right 944893977 2:204145346-204145368 GGCTTCTCTTTGTCCAGGTGGGG No data
944893973_944893975 -5 Left 944893973 2:204145326-204145348 CCAAAAGCAGGTGAGGATGAGGC No data
Right 944893975 2:204145344-204145366 GAGGCTTCTCTTTGTCCAGGTGG No data
944893973_944893980 21 Left 944893973 2:204145326-204145348 CCAAAAGCAGGTGAGGATGAGGC No data
Right 944893980 2:204145370-204145392 CACGGTCTCTCCCGCCCCTCCGG No data
944893973_944893974 -8 Left 944893973 2:204145326-204145348 CCAAAAGCAGGTGAGGATGAGGC No data
Right 944893974 2:204145341-204145363 GATGAGGCTTCTCTTTGTCCAGG No data
944893973_944893981 24 Left 944893973 2:204145326-204145348 CCAAAAGCAGGTGAGGATGAGGC No data
Right 944893981 2:204145373-204145395 GGTCTCTCCCGCCCCTCCGGCGG No data
944893973_944893976 -4 Left 944893973 2:204145326-204145348 CCAAAAGCAGGTGAGGATGAGGC No data
Right 944893976 2:204145345-204145367 AGGCTTCTCTTTGTCCAGGTGGG No data
944893973_944893978 3 Left 944893973 2:204145326-204145348 CCAAAAGCAGGTGAGGATGAGGC No data
Right 944893978 2:204145352-204145374 TCTTTGTCCAGGTGGGGACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944893973 Original CRISPR GCCTCATCCTCACCTGCTTT TGG (reversed) Intergenic
No off target data available for this crispr