ID: 944894156

View in Genome Browser
Species Human (GRCh38)
Location 2:204146793-204146815
Sequence CTTTAGGAAGGAAGGGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944894150_944894156 13 Left 944894150 2:204146757-204146779 CCAGGATGCTCGTACTCATCTCT No data
Right 944894156 2:204146793-204146815 CTTTAGGAAGGAAGGGAAATTGG No data
944894148_944894156 30 Left 944894148 2:204146740-204146762 CCGGTGGAACCTATAAACCAGGA No data
Right 944894156 2:204146793-204146815 CTTTAGGAAGGAAGGGAAATTGG No data
944894149_944894156 21 Left 944894149 2:204146749-204146771 CCTATAAACCAGGATGCTCGTAC No data
Right 944894156 2:204146793-204146815 CTTTAGGAAGGAAGGGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944894156 Original CRISPR CTTTAGGAAGGAAGGGAAAT TGG Intergenic
No off target data available for this crispr