ID: 944895733 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:204162179-204162201 |
| Sequence | CTGTAAAAACATCTGGATCA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 944895733_944895737 | 17 | Left | 944895733 | 2:204162179-204162201 | CCCTGATCCAGATGTTTTTACAG | No data | ||
| Right | 944895737 | 2:204162219-204162241 | TTCAAATAAGAGATAATCTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 944895733 | Original CRISPR | CTGTAAAAACATCTGGATCA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||