ID: 944895733

View in Genome Browser
Species Human (GRCh38)
Location 2:204162179-204162201
Sequence CTGTAAAAACATCTGGATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944895733_944895737 17 Left 944895733 2:204162179-204162201 CCCTGATCCAGATGTTTTTACAG No data
Right 944895737 2:204162219-204162241 TTCAAATAAGAGATAATCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944895733 Original CRISPR CTGTAAAAACATCTGGATCA GGG (reversed) Intergenic
No off target data available for this crispr