ID: 944897865

View in Genome Browser
Species Human (GRCh38)
Location 2:204183920-204183942
Sequence CAGGGTAAACGCAATGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944897858_944897865 12 Left 944897858 2:204183885-204183907 CCTACTGTGGGAAGATGTGCTTT No data
Right 944897865 2:204183920-204183942 CAGGGTAAACGCAATGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944897865 Original CRISPR CAGGGTAAACGCAATGATGA GGG Intergenic
No off target data available for this crispr