ID: 944905229

View in Genome Browser
Species Human (GRCh38)
Location 2:204255623-204255645
Sequence TCCCAGTGAATAAGGTCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 341}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944905225_944905229 25 Left 944905225 2:204255575-204255597 CCTGACTTCTCTTTCCTCCTGTA 0: 1
1: 0
2: 4
3: 38
4: 443
Right 944905229 2:204255623-204255645 TCCCAGTGAATAAGGTCAAGAGG 0: 1
1: 0
2: 1
3: 21
4: 341
944905223_944905229 27 Left 944905223 2:204255573-204255595 CCCCTGACTTCTCTTTCCTCCTG 0: 1
1: 0
2: 5
3: 58
4: 794
Right 944905229 2:204255623-204255645 TCCCAGTGAATAAGGTCAAGAGG 0: 1
1: 0
2: 1
3: 21
4: 341
944905226_944905229 11 Left 944905226 2:204255589-204255611 CCTCCTGTATCACAAGAGTGACA 0: 1
1: 0
2: 1
3: 17
4: 127
Right 944905229 2:204255623-204255645 TCCCAGTGAATAAGGTCAAGAGG 0: 1
1: 0
2: 1
3: 21
4: 341
944905224_944905229 26 Left 944905224 2:204255574-204255596 CCCTGACTTCTCTTTCCTCCTGT 0: 1
1: 0
2: 11
3: 92
4: 778
Right 944905229 2:204255623-204255645 TCCCAGTGAATAAGGTCAAGAGG 0: 1
1: 0
2: 1
3: 21
4: 341
944905227_944905229 8 Left 944905227 2:204255592-204255614 CCTGTATCACAAGAGTGACAAGT 0: 1
1: 0
2: 0
3: 9
4: 128
Right 944905229 2:204255623-204255645 TCCCAGTGAATAAGGTCAAGAGG 0: 1
1: 0
2: 1
3: 21
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944905229 Original CRISPR TCCCAGTGAATAAGGTCAAG AGG Intergenic
905354333 1:37370633-37370655 GCCCTGTGATTAAGGTCAATGGG + Intergenic
906927349 1:50132571-50132593 TCACAGTGATTTAGGTGAAGGGG + Intronic
906930666 1:50166674-50166696 GCCCTGTGATTAAGGTCAATGGG - Intronic
907597600 1:55733971-55733993 GCCCTGTGATTAAGGTCAATGGG + Intergenic
907780635 1:57563003-57563025 GCCCTGTGATTAAGGTCAATGGG + Intronic
908052570 1:60248551-60248573 GCCCTGTGATTAAGGTCAATGGG + Intergenic
909577175 1:77187683-77187705 GCCCTGTGATTAAGGTCAATGGG + Intronic
909650180 1:77966237-77966259 TCTCAGTAAATAAGCTTAAGTGG + Intronic
910562147 1:88601809-88601831 GCCCTGTGATTAAGGTCAACGGG + Intergenic
910630466 1:89348107-89348129 GCCCTGTGATTAAGGTCAATGGG + Intergenic
910791556 1:91056298-91056320 GCCCTGTGATTAAGGTCAATGGG - Intergenic
910948467 1:92618557-92618579 GCCCTGTGATTAAGGTCAATGGG + Intronic
911257083 1:95645511-95645533 GCCCTGTGATTAAGGTCAATGGG - Intergenic
911462210 1:98205417-98205439 TCCCAGTGGCTATGGGCAAGTGG - Intergenic
912251779 1:108019630-108019652 GCCCTGTGATTAAGGTCAATGGG - Intergenic
912943499 1:114066051-114066073 GCCCTGTGATTAAGGTCAATGGG - Intergenic
913039194 1:115006543-115006565 GCCCTGTGATTAAGGTCAATGGG - Intergenic
913559414 1:120002429-120002451 GCCCTGTGATTAAGGTCAATGGG + Intronic
913638448 1:120788113-120788135 GCCCTGTGATTAAGGTCAATGGG - Intergenic
914280008 1:146161872-146161894 GCCCTGTGATTAAGGTCAATGGG + Intronic
914541048 1:148612790-148612812 GCCCTGTGATTAAGGTCAATGGG + Intronic
914625594 1:149458456-149458478 GCCCTGTGATTAAGGTCAATGGG - Intergenic
914771754 1:150692838-150692860 TTCCAGTGCATAAGGTCAGCAGG + Intronic
915667420 1:157457846-157457868 GCCCTGTGATTAAGGTCAATGGG - Intergenic
915768371 1:158390918-158390940 TCCCAGAGAAAAATGTGAAGAGG - Intergenic
916265139 1:162882987-162883009 TCCCAGAAAATGAGGTCAACAGG - Intergenic
917216966 1:172689059-172689081 GCCCTGTGATTAAGGTCAATGGG - Intergenic
917878804 1:179312938-179312960 TCCCAGTCAATAAGCTTGAGTGG + Intronic
918205457 1:182304415-182304437 TGCCAGTGAAGAAGGAAAAGGGG + Intergenic
918768712 1:188523703-188523725 GCCCTGTGATTAAGGTCAATGGG + Intergenic
919242056 1:194926370-194926392 GCCCTGTGATTAAGGTCAATGGG + Intergenic
922239318 1:223745207-223745229 TCCCAGGGGATCAGGGCAAGGGG + Intronic
924258557 1:242206728-242206750 TCACATTGAATAAGCTCAGGAGG + Intronic
1063773352 10:9230010-9230032 TTTCAGTTAATGAGGTCAAGGGG - Intergenic
1064155290 10:12898551-12898573 AGCGAGTGAAGAAGGTCAAGAGG - Exonic
1064344502 10:14519238-14519260 CCCCTGTGAATACGATCAAGTGG + Exonic
1064814625 10:19245168-19245190 TCTCAGTGCATAAGCTCATGCGG - Intronic
1066169795 10:32829163-32829185 GCCCTGTGATTAAGGTCAATGGG + Intronic
1066196809 10:33108145-33108167 TCCCAATGAATCAGGTCAAAAGG + Intergenic
1068007406 10:51407741-51407763 GCCCTGTGATTAAGGTCAATGGG - Intronic
1068909141 10:62359459-62359481 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1069146005 10:64892271-64892293 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1069192056 10:65504530-65504552 GCCCTGTGATTAAGGTCAATAGG - Intergenic
1069895651 10:71678736-71678758 TCCCAGAGAAGACAGTCAAGGGG + Intronic
1071033000 10:81206620-81206642 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1071378633 10:85035209-85035231 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1072209009 10:93229851-93229873 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1072265265 10:93721136-93721158 TCCCAGTGAAGATGGGAAAGAGG + Intergenic
1073557610 10:104467743-104467765 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1073957513 10:108890374-108890396 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1073995628 10:109312938-109312960 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1074332245 10:112526324-112526346 TCCCAGTAAATAAAGACAAGTGG - Intronic
1074445836 10:113520339-113520361 ACCCAGTGACTCAGGTCAACTGG + Intergenic
1075299100 10:121304921-121304943 TGCAAGTGAAGAAGGTAAAGAGG - Intergenic
1076117371 10:127909513-127909535 TCCCAGGGAGAAATGTCAAGTGG - Intronic
1076123533 10:127955142-127955164 ACCCTGTGATTAAGGTCAATTGG + Intronic
1078702491 11:13700403-13700425 TCTCAGTGAAGAAGATAAAGAGG + Exonic
1079648363 11:22895441-22895463 TGACAGTGAGGAAGGTCAAGGGG - Intergenic
1080076853 11:28159345-28159367 GCCCTGTGATTAAGGTCAATGGG + Intronic
1081609319 11:44549713-44549735 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1081765438 11:45606865-45606887 TCCCAGGATAAAAGGTCAAGGGG + Intergenic
1082836067 11:57650908-57650930 GCCCTGTGATTAAGGTCAATGGG + Intronic
1083180829 11:60984005-60984027 TCCCAGTGAATCATATCAGGAGG + Intronic
1084517310 11:69643845-69643867 TCCTGGTGAACAAGCTCAAGTGG + Exonic
1084889418 11:72229345-72229367 TACCAGTGAGGAAAGTCAAGAGG - Intronic
1085686219 11:78624011-78624033 TCCCTGTAATTAAGGTCAATGGG + Intergenic
1085937885 11:81171868-81171890 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1086278858 11:85162265-85162287 GCCCTGTGATTAAGGTCAATGGG + Intronic
1086581144 11:88400332-88400354 TTCCTGTGAATAGAGTCAAGGGG - Intergenic
1088449590 11:109967133-109967155 ACCCTGTGATTAAGGTCAATGGG + Intergenic
1088836907 11:113585205-113585227 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1089620297 11:119718259-119718281 TCCCAGGGAAGAAGATCACGGGG - Intronic
1090197022 11:124825500-124825522 ACCCTGTGATTAAGGTCAATGGG - Intergenic
1090221364 11:125029809-125029831 GCCCTGTGATTAAGGTCAATGGG - Intronic
1092093877 12:5825776-5825798 GCCCTGTGATTAAGGTCAATGGG + Intronic
1092381875 12:8003227-8003249 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1092978790 12:13772482-13772504 TCCCAAAGAATCAGGGCAAGTGG - Intronic
1093031555 12:14293791-14293813 GCCCTGTGATTAAGGTCAATCGG - Intergenic
1093613249 12:21188775-21188797 TGCCAGTGATTAAGGGGAAGGGG - Intronic
1093964798 12:25312765-25312787 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1093981364 12:25478970-25478992 GCCCTGTGATTAAGGTCAATGGG - Intronic
1095604149 12:44046466-44046488 GCCCTGTGATTAAGGTCAATGGG + Intronic
1095844144 12:46728158-46728180 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1095856002 12:46861860-46861882 GCCCCGTGATTAAGGTCAATGGG - Intergenic
1096289023 12:50325074-50325096 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1096457203 12:51797627-51797649 GCCCTGTGATTAAGGTCAATGGG - Intronic
1097437576 12:59570438-59570460 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1097554831 12:61123426-61123448 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1097793438 12:63839337-63839359 TCCCAGGGCATATGGTCAAGTGG + Intergenic
1097957384 12:65500297-65500319 ACACAGTGAAAAAGATCAAGGGG + Intergenic
1098026113 12:66203299-66203321 TCTCAGTGCATAATATCAAGAGG - Intronic
1098750076 12:74281419-74281441 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1098831627 12:75371892-75371914 TGCCTGTGATTAAGGTCAATGGG - Intronic
1099400999 12:82203937-82203959 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1099526603 12:83724910-83724932 ACCCTGTGATTAAGGTCAATGGG + Intergenic
1099700638 12:86077734-86077756 GCCCTGTGATTAAGGTCAATGGG - Intronic
1099736074 12:86567548-86567570 GCCCTGTGATTAAGGTCAATGGG + Intronic
1101264389 12:103067948-103067970 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1101708864 12:107246398-107246420 GCCCAGTGGAGAAGCTCAAGTGG - Intergenic
1101917874 12:108910312-108910334 TCCCAGAGACTAGGGTAAAGGGG - Intergenic
1102435726 12:112921846-112921868 TCACAGTGAGGAAGGTCATGGGG - Intronic
1103396786 12:120613263-120613285 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1105457145 13:20551556-20551578 CCCCAGTGAAGAAAGTCAAGGGG - Intergenic
1105740419 13:23317293-23317315 GCCCTGTGATTAAGGTCAATGGG + Intronic
1107164732 13:37271055-37271077 TCCAAGTAGATGAGGTCAAGTGG + Intergenic
1107478340 13:40763076-40763098 TCCAAATGAATCAGGTTAAGAGG + Intronic
1107983330 13:45754139-45754161 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1108914064 13:55587081-55587103 GCCCTGTGATTAAGTTCAAGGGG - Intergenic
1109516130 13:63444235-63444257 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1109519272 13:63486617-63486639 GCCCTGTGATTAAGGTCAATAGG + Intergenic
1109712441 13:66179039-66179061 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1110377407 13:74808342-74808364 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1110377526 13:74809485-74809507 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1110833892 13:80062796-80062818 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1111317734 13:86583623-86583645 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1111535446 13:89596993-89597015 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1112230869 13:97588343-97588365 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1112832582 13:103471874-103471896 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1113396392 13:109951425-109951447 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1115000018 14:28410874-28410896 TCCCAGTAGATAACCTCAAGGGG - Intergenic
1115059949 14:29175707-29175729 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1115130929 14:30051086-30051108 GCCCTGTGATTAAGGTCAATGGG + Intronic
1116158149 14:41234831-41234853 GCCCAGTGATTAAGGTCAAAGGG - Intergenic
1116415324 14:44671189-44671211 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1118122182 14:62858359-62858381 GCCCTGTGATTAAGGTCAATGGG - Intronic
1119107301 14:71937018-71937040 GCCCTGTGATTAAGGTCAACAGG - Intronic
1120498163 14:85261770-85261792 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1120973947 14:90232633-90232655 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1124781395 15:32638942-32638964 TCCAAGTAAAAAAGGTAAAGAGG - Exonic
1126283850 15:46988076-46988098 GCCCTGTGACTAAGGTCAATGGG + Intergenic
1127357035 15:58210058-58210080 GCCCTGTGATTAAGGTCAATGGG + Intronic
1128936749 15:71753007-71753029 TCCGACTCAATAAGCTCAAGAGG + Intronic
1131658946 15:94493114-94493136 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1132217861 15:100080449-100080471 GCCCTGTGACTAAGGTCAATGGG + Intronic
1133404093 16:5509341-5509363 TCCCTGTGAATGAGGAGAAGCGG + Intergenic
1133699898 16:8299169-8299191 TCCCTGTGTTTGAGGTCAAGGGG + Intergenic
1135394205 16:22118767-22118789 TCCCAGTGTATAAGGCCTGGTGG + Intronic
1135682560 16:24470572-24470594 TCACACTGAATAGGGTGAAGAGG - Intergenic
1138868629 16:60852622-60852644 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1139534282 16:67562192-67562214 AGCTAGGGAATAAGGTCAAGCGG + Intergenic
1141559280 16:84856211-84856233 GCCCTGTGATTAAGGTCAATGGG - Intronic
1143105043 17:4525320-4525342 TCCCAGTGCAGAAGGACAGGTGG + Intronic
1147410059 17:40244235-40244257 ACACAGGGAATAATGTCAAGAGG - Intronic
1148635438 17:49145686-49145708 GCCCTGTGATTAAGGTCAATGGG - Intronic
1149427921 17:56572667-56572689 TCCCACTGAATATGGTCGACTGG + Intergenic
1150814430 17:68381693-68381715 TCCCAGGGAAGGAGGGCAAGGGG - Intronic
1151526878 17:74676191-74676213 TACCAGTGAATTAGGACAAAAGG + Intronic
1153684980 18:7536737-7536759 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1154252313 18:12754935-12754957 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1156582637 18:38395084-38395106 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1156990062 18:43398963-43398985 ACCCTGTGATTAAGGTCAATGGG - Intergenic
1157341462 18:46781830-46781852 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1159558852 18:69973557-69973579 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1165142292 19:33707004-33707026 TCACAGTGAGTAAGGTGATGGGG + Intronic
1165211034 19:34235998-34236020 TGCCAGTGAGTAAGGGCAATGGG - Intergenic
1168531657 19:57134621-57134643 TTCCAGTGAATAATGACCAGTGG - Exonic
1168539082 19:57195589-57195611 GCCCTGTGATTAAGGTCAATGGG - Intronic
925280207 2:2678672-2678694 GCCCTGTGATTAAGGTCAATGGG + Intergenic
926142282 2:10374884-10374906 TCTGGGTGAATAAGGACAAGGGG - Intronic
929269575 2:39958989-39959011 GCCCTGTGATTAAGGTCAATGGG - Intergenic
930493571 2:52108538-52108560 TCCTAGTGAATGTGGTCAAGAGG - Intergenic
932870438 2:75393261-75393283 GCCCTGTGATTAAGGTCAATGGG - Intergenic
934942948 2:98515625-98515647 CCCCAGTGAATAAGCAAAAGTGG + Intronic
935424867 2:102909616-102909638 GCCCTGTGATTAAGGTCAATGGG - Intergenic
935527070 2:104183204-104183226 GCCCTGTGATTAAGGTCAATGGG + Intergenic
935564053 2:104588434-104588456 GCCCTGTGATTAAGGTCAATGGG - Intergenic
935591635 2:104850890-104850912 TCCCAGAGAATCAGGACTAGAGG - Intergenic
935693823 2:105753500-105753522 TCACAGTGTATTAGCTCAAGTGG + Intronic
936641459 2:114316516-114316538 GCCCTGTGATTAAGGTCAATGGG + Intergenic
937765877 2:125659815-125659837 ACCCTGTGATTAAGGTCAAGGGG + Intergenic
937800907 2:126079125-126079147 GCCCTGTGATTAAGGTCAATGGG + Intergenic
938062513 2:128264199-128264221 TCCCAGTGACAAAGGTCACCAGG - Intronic
939214115 2:139214063-139214085 GCCCTGTGATTAAGGTCAATGGG + Intergenic
940171068 2:150830877-150830899 GCCCTGTGATTAAGGTCAATGGG - Intergenic
940471839 2:154111298-154111320 GCCCTGTGATTAAGGTCAATGGG - Intronic
940574959 2:155491387-155491409 TCCCAGTGCAGAAAGTCTAGAGG + Intergenic
941289647 2:163659587-163659609 TCCCAGAGAATCATATCAAGTGG + Intronic
941330416 2:164172743-164172765 GCCCTGTGATTAAGGTCAATGGG - Intergenic
941387038 2:164866425-164866447 GCCCTGTGATTAAGGTCAATGGG + Intergenic
942322185 2:174745363-174745385 ACCCTGTGATTAAGGTCAATGGG + Intergenic
942645257 2:178103346-178103368 TGCCAGGGAATAGGGTTAAGGGG + Intronic
943367537 2:186980355-186980377 TCCTAGTGAGTAAGGCCAGGTGG - Intergenic
943704359 2:191019557-191019579 TTCCAGTTAATAAGTACAAGAGG + Intronic
944668926 2:201979398-201979420 TCCCAGAGAAAAAGGCCAAGGGG - Intergenic
944905229 2:204255623-204255645 TCCCAGTGAATAAGGTCAAGAGG + Intergenic
946703511 2:222435985-222436007 TCCCTGTGATTAAGGTCAATGGG - Intronic
947314430 2:228840269-228840291 TCCCAGTTCATAAGGTAATGCGG + Intergenic
947441101 2:230122077-230122099 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1170128218 20:12989103-12989125 TCCCAGTGAAGAAGGGAAAAAGG - Intergenic
1170203390 20:13769135-13769157 TCCTAGGGAATAAGGGGAAGTGG - Intronic
1174098563 20:48108927-48108949 ACCCAACAAATAAGGTCAAGAGG - Intergenic
1175759670 20:61553265-61553287 TTCCAGAGAATAAGGAGAAGGGG + Intronic
1176937111 21:14880245-14880267 TCCCAGGGATGAAGGACAAGAGG - Intergenic
1177267961 21:18808761-18808783 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1181367068 22:22386075-22386097 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1182765840 22:32757767-32757789 GCCCTGTGATTAAGGTCAATGGG + Intronic
1184603301 22:45556540-45556562 GCCCTGTGATTAAGGTCAATGGG - Intronic
1184938849 22:47746029-47746051 GCCCTGTGATTAAGGTCAACAGG - Intergenic
949125408 3:441269-441291 GCCCTGTGATTAAGGTCAATGGG - Intergenic
949445862 3:4132883-4132905 GCCCTGTGATTAAGGTCAATAGG + Intronic
950820865 3:15757033-15757055 TCACATTGAATAAGGTGAAGAGG - Intronic
951291105 3:20873227-20873249 GCCCTGTGATTAAGGTCAATGGG - Intergenic
951384770 3:22029340-22029362 GCCCTGTGATTAAGGTCAATGGG + Intronic
952330232 3:32357847-32357869 TCCCTGTGAACAATGTCAACTGG + Intronic
954511245 3:51127866-51127888 GCCCTGTGATTAAGGTCAATGGG - Intronic
954597614 3:51840040-51840062 TCCTAGTGAGAAAGGCCAAGTGG + Intergenic
956307111 3:67837451-67837473 GCCCTGTGATTAAGGTCAATTGG + Intergenic
956360359 3:68440708-68440730 TCCCTGTGACTAAGGTCAATGGG - Intronic
956703649 3:71981077-71981099 GCCCTGTGACTAAGGTCAATGGG - Intergenic
957689820 3:83553439-83553461 GCCCTGTGATTAAGGTCAATGGG - Intergenic
957754829 3:84471252-84471274 GCCCTGTGATTAAGGTCAATGGG + Intergenic
958258771 3:91354916-91354938 GCCCTGTGATTAAGGTCAATGGG - Intergenic
958715350 3:97773993-97774015 GCCCTGTGATTAAGGTCAATGGG - Intronic
958845534 3:99260599-99260621 GCCCTGTGATTAAGGTCAATGGG - Intergenic
958934555 3:100242431-100242453 GCCCTGTGATTAAGGTCAATGGG + Intergenic
959226538 3:103595461-103595483 GCCCTGTGATTAAGGTCAATGGG - Intergenic
959289191 3:104450769-104450791 GCCCTGTGATTAAGGTCAATGGG - Intergenic
960998819 3:123358650-123358672 TCCGAGTGGACAAGGTCCAGGGG + Intronic
961263104 3:125618214-125618236 GCCCTGTGATTAAGGTCAACGGG + Intergenic
961710728 3:128826197-128826219 GCCCTGTGATTAAGGTCAATGGG - Intergenic
963378996 3:144505460-144505482 GCCCTGTGATTAAGGTCAATGGG - Intergenic
963970064 3:151420135-151420157 GCCCTGTGATTAAGGTCAATGGG - Intronic
964146756 3:153473159-153473181 GCCCTGTGATTAAGGTCAATGGG + Intergenic
965034757 3:163424114-163424136 GCCCTGTGATTAAGGTCAATGGG - Intergenic
966044085 3:175529086-175529108 GCCCTGTGATTAAGGTCAATGGG - Intronic
966445938 3:180000393-180000415 GCCCTGTGATTAAGGTCAATGGG + Intronic
968722641 4:2219044-2219066 TCCTAGTGAGTAAGCTCAAGTGG - Intronic
968800493 4:2740266-2740288 GCCCTGTGATTAAGGTCAATGGG + Intergenic
968907266 4:3460234-3460256 GCCCTGTGATTAAGGTCAATGGG + Intergenic
970629538 4:17925327-17925349 GCCCTGTGATTAAGGTCAATGGG + Intronic
971687137 4:29785270-29785292 GCCCTGTGATTAAGGTCAATGGG - Intergenic
971979060 4:33731050-33731072 GCCCTGTGATTAAGGTCAATGGG - Intergenic
972806180 4:42531195-42531217 GCCCTGTGATTAAGGTCAATGGG + Intronic
973103156 4:46296555-46296577 GCCCTGTGATTAAGGTCAATGGG + Intronic
973129938 4:46637904-46637926 GCCCTGTGATTAAGGTCAATGGG - Intergenic
974459255 4:62166075-62166097 GCCCTGTGATTAAGGTCAATGGG + Intergenic
974746731 4:66087468-66087490 GCCCAGTGACTAAGGTCAATGGG - Intergenic
975982367 4:80175452-80175474 GCCCTGTGATTAAGGTCAATGGG - Intergenic
976301061 4:83516010-83516032 ACCCTGTGATTAAGGTCAATGGG - Intronic
977431012 4:96930016-96930038 GCCCTGTGATTAAGGTCAATGGG + Intergenic
978341325 4:107723728-107723750 ACCCTGTGATTAAGGTCAATGGG - Intergenic
978771900 4:112465963-112465985 GCCCTGTGATTAAGGTCAATGGG - Intergenic
978898815 4:113925017-113925039 GCCCTGTGATTAAGGTCAATGGG - Intronic
979138793 4:117146603-117146625 TCCCTGTGATAAAGGTCAATGGG + Intergenic
979507319 4:121513477-121513499 GCCCTGTGATTAAGGTCAATGGG - Intergenic
980352683 4:131701553-131701575 TGCCAGTCAAAGAGGTCAAGTGG + Intergenic
980385556 4:132085230-132085252 GCCCCGTGATTAAGGTCAATGGG - Intergenic
980513711 4:133825725-133825747 GCCCTGTGATTAAGGTCAATGGG + Intergenic
981463054 4:145033600-145033622 GCCCTGTGATTAAGGTCAATGGG + Intronic
982623088 4:157731068-157731090 GCCCAGTGATTAAGGTCAATGGG - Intergenic
983027651 4:162757107-162757129 GCCCTGTGATTAAGGTCAATGGG + Intergenic
983375795 4:166926468-166926490 TCCCATTGAATTATTTCAAGCGG - Intronic
985076412 4:186219811-186219833 GCCCTGTGATTAAGGTCAATGGG - Intronic
986261388 5:6150704-6150726 GCCCTGTGATTAAGGTCAATGGG - Intergenic
987043236 5:14082783-14082805 TCACAGTGAATAAGGGATAGGGG - Intergenic
987153435 5:15063479-15063501 GCCCTGTGATTAAGGTCAATGGG + Intergenic
987495939 5:18644853-18644875 TCCCAATGAAAAAGATGAAGAGG + Intergenic
987504635 5:18751656-18751678 GCCCTGTGATTAAGGTCAATGGG + Intergenic
988785283 5:34561134-34561156 GCCCTGTGATTAAGGTCAATGGG - Intergenic
989285429 5:39693397-39693419 TCACAGTGAGGAATGTCAAGTGG - Intergenic
991330496 5:65487873-65487895 GCCCAGTGATTAAGGTCAATGGG - Intergenic
991946397 5:71901945-71901967 GCCCTGTGATTAAGGTCAATGGG + Intergenic
992243208 5:74791677-74791699 GCCCTGTGATTAAGGTCAATGGG + Intronic
993203643 5:84849363-84849385 GCCCTGTGATTAAGGTCAATGGG + Intergenic
993321021 5:86467254-86467276 CCCCTGTGATTAAGGTCAATGGG + Intergenic
993384033 5:87242394-87242416 TCTCAGTGAATAATGTCAAGGGG + Intergenic
994984167 5:106913917-106913939 GCCCTGTGATTAAGGTCAATGGG - Intergenic
995776025 5:115725889-115725911 GCCCTGTGATTAAGGTCAATGGG - Intergenic
996164677 5:120210412-120210434 GCCCTGTGACTAAGGTCAATGGG - Intergenic
997029262 5:130104946-130104968 TCCAAGCATATAAGGTCAAGTGG - Intronic
1000725677 5:164767704-164767726 TCTCAGTGAATAAGATTGAGAGG - Intergenic
1000730676 5:164830096-164830118 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1000979172 5:167798401-167798423 TCCTGGTGAATTAGGACAAGAGG + Intronic
1001744011 5:174076254-174076276 TCCCAGTGAAAGAAGTTAAGGGG - Intronic
1001749736 5:174119516-174119538 TCCAAGTGAAGAAGGCAAAGGGG + Intronic
1002998226 6:2306587-2306609 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1005185415 6:23158882-23158904 CCCCTGTGATTAAGGTCAATGGG + Intergenic
1006062584 6:31435017-31435039 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1007205229 6:40144622-40144644 TTCCAGAGAATATGGTCAGGTGG - Intergenic
1008016371 6:46525034-46525056 TCCCGGAGAATAAGGCCATGTGG + Intergenic
1008079134 6:47176747-47176769 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1008820633 6:55626948-55626970 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1008996485 6:57665658-57665680 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1009806729 6:68608768-68608790 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1010323816 6:74542308-74542330 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1010552403 6:77238671-77238693 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1010580570 6:77592430-77592452 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1010818874 6:80390224-80390246 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1011039105 6:83011486-83011508 GCCCTGTGATTAAGGTCAATGGG - Intronic
1011830291 6:91363744-91363766 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1014417238 6:121197233-121197255 GCCCTGTGATTAAGGTCAATGGG + Intronic
1015476008 6:133659313-133659335 ACCCTGTGAATAAGGTCAATGGG + Intergenic
1016576017 6:145570764-145570786 GCCCTGTGATTAAGGTCAATGGG - Intronic
1016594769 6:145786967-145786989 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1019633473 7:2062899-2062921 TCCCAGGGACGAAGGTCAAAAGG + Intronic
1020710556 7:11599095-11599117 GCCCTGTGATTAAGGTCAATAGG + Intronic
1020710570 7:11599194-11599216 GCCCTGTGATTAAGGTCAATGGG + Intronic
1021182161 7:17519370-17519392 TCCTATTGAATAAGGTTTAGAGG - Intergenic
1021853951 7:24834931-24834953 TCCCTGTGAATAAAGTCGATGGG - Intronic
1021989069 7:26124742-26124764 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1024884113 7:54122838-54122860 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1025622702 7:63188692-63188714 TCCCACTGCATAAGTTCAGGAGG + Intergenic
1026046237 7:66907331-66907353 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1027686048 7:81279771-81279793 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1027761470 7:82284706-82284728 TCACAGGTAATAAGGTCATGAGG - Intronic
1028141980 7:87283839-87283861 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1029447446 7:100621727-100621749 GCCCAGAGACGAAGGTCAAGGGG + Intronic
1030355665 7:108539347-108539369 GCCCTGTGATTAAGGTCAATGGG + Intronic
1030762505 7:113368938-113368960 TGCCAGTGAATATGAACAAGGGG - Intergenic
1030931043 7:115523849-115523871 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1031861270 7:126982911-126982933 GCCCTGTGATTAAGGTCAATGGG - Intronic
1034018186 7:147609840-147609862 TCCCAGGGAAGAAGGTAGAGTGG + Intronic
1036168056 8:6456443-6456465 TCCAAATGAACTAGGTCAAGCGG - Intronic
1037220940 8:16519449-16519471 TCCCAAAGATTAAGGTCATGAGG + Intronic
1037439335 8:18898793-18898815 TCTCATTGAATAAGCTGAAGAGG + Intronic
1040912182 8:52530233-52530255 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1042586416 8:70344228-70344250 TCCCACTGAATGAGGTGGAGAGG + Intronic
1043258260 8:78161989-78162011 TCCCTGTGATTAAGGTCAATGGG + Intergenic
1044151038 8:88774894-88774916 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1049538769 8:143195951-143195973 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1050053135 9:1623725-1623747 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1050902082 9:10961734-10961756 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1051357928 9:16256462-16256484 TCCCAGTTAAAAAGGGAAAGGGG + Intronic
1056772994 9:89493008-89493030 TGCCGGGGAATATGGTCAAGTGG - Intronic
1058259023 9:102807889-102807911 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1058711444 9:107682519-107682541 ACCCAGTGAATAAGTTCACAGGG + Intergenic
1059297171 9:113281736-113281758 CCTCAGTTAATCAGGTCAAGGGG - Intronic
1060051991 9:120384291-120384313 TCCCAGGGAATGGGGTCAATGGG + Intergenic
1186469505 X:9810316-9810338 GCCCTGTGATTAAGGTCAAGGGG - Intronic
1187230288 X:17415167-17415189 TCCCAGGGAACAAGTTCAAAAGG - Intronic
1191133817 X:57042720-57042742 GCCCTGTGACTAAGGTCAATGGG - Intergenic
1191629778 X:63310771-63310793 TCCGTGTGACTAAGGTCAATGGG - Intergenic
1192209277 X:69117326-69117348 TCCCGGTGAATTGGGTCAAGTGG - Intergenic
1193053739 X:77127582-77127604 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1193573472 X:83173363-83173385 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1193833197 X:86311925-86311947 GCCCTGTGATTAAGGTCAATGGG + Intronic
1193904705 X:87227642-87227664 GCCCAGTGATTAAGGTCAATGGG + Intergenic
1193914573 X:87350144-87350166 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1193979129 X:88159236-88159258 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1194233095 X:91348102-91348124 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1194277182 X:91900048-91900070 GCCCTGTGATTAAGGTCAATTGG - Intronic
1194343548 X:92732903-92732925 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1194457191 X:94119294-94119316 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1194513184 X:94820447-94820469 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1194584360 X:95714880-95714902 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1194604135 X:95960038-95960060 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1194834184 X:98660619-98660641 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1195748662 X:108143426-108143448 GCCCTGTGATTAAGGTCAATGGG - Intronic
1195782096 X:108478064-108478086 TCTCTGTGATTAAGGTCAATGGG - Intronic
1195809546 X:108815026-108815048 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1196585539 X:117423138-117423160 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1197236486 X:124071654-124071676 TACCAATGAATAAGGGCAAGAGG - Intronic
1197244802 X:124157165-124157187 GCCCTGTGATTAAGGTCAATGGG - Intronic
1197405407 X:126042017-126042039 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1197477139 X:126939743-126939765 GCCCTGTGATTAAGGTCAATGGG - Intergenic
1198047172 X:132914346-132914368 TCCCTGTGAATAAGGCAAAAAGG + Intronic
1198260961 X:134964593-134964615 TCCCAGGGAACATGGTCAGGAGG + Intergenic
1198412249 X:136382622-136382644 GCCCTGTGATTAAGGTCAATGGG - Intronic
1198663138 X:138992974-138992996 TCCCAGTGCATGATATCAAGAGG - Intronic
1198934283 X:141889670-141889692 GCCCTGTGATTAAGGTCAATGGG + Intronic
1200509972 Y:4065683-4065705 GCCCTGTGAGTAAGGTCAATAGG - Intergenic
1200594526 Y:5122147-5122169 GCCCTGTGATTAAGGTCAATTGG - Intronic
1200651903 Y:5849568-5849590 GCCCTGTGATTAAGGTCAATGGG + Intergenic
1201529425 Y:14976086-14976108 GCCCTGTGAATAAGATCAATGGG - Intergenic