ID: 944907406

View in Genome Browser
Species Human (GRCh38)
Location 2:204276287-204276309
Sequence TCAGCTTGGAAGGGTAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 1, 2: 3, 3: 16, 4: 292}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944907406 Original CRISPR TCAGCTTGGAAGGGTAAAGC AGG (reversed) Intergenic
901387474 1:8920678-8920700 TCTGCTTGGGAGGCTAAAGCAGG + Intergenic
903360851 1:22776108-22776130 TGAGCCTGGAGGGGTTAAGCAGG - Intronic
903908436 1:26703961-26703983 TCAGTTTGGCAGGGTTAACCTGG + Intronic
905167935 1:36094087-36094109 TCAGCCAGGAAGGGCACAGCAGG + Intergenic
907239953 1:53075843-53075865 TCAGCTGGGAAGGGAAGAGTTGG - Exonic
908183386 1:61628134-61628156 TCAACTTGGAAGGCTGAGGCAGG + Intergenic
909912860 1:81281593-81281615 TCAGCTTGGAAGTACAAAGGTGG - Intergenic
911684437 1:100758589-100758611 TCAGTTAGGAAGAGTAAATCTGG - Intergenic
913082215 1:115399266-115399288 TCAGATTGGAAGCCCAAAGCTGG + Intergenic
913511550 1:119567247-119567269 GCTGCTTGGAAGGCTGAAGCAGG - Intergenic
914934462 1:151966200-151966222 TGAGCTGGGAAGAGTACAGCTGG - Intergenic
915949944 1:160182781-160182803 GCTGCTTGGAAGGCTGAAGCAGG - Intronic
916212112 1:162367620-162367642 TCTGCTTTGGAGGGTAAAGTGGG + Exonic
916489315 1:165287540-165287562 TCATCTGGGAAGGGTGAAGGTGG + Intronic
918739737 1:188113958-188113980 ACAGTTTGGAAGGCTAAGGCGGG - Intergenic
918843404 1:189575270-189575292 GCTACTCGGAAGGGTAAAGCAGG - Intergenic
920272126 1:204773541-204773563 TCACATTGTAAGGGGAAAGCTGG - Intergenic
921894409 1:220384506-220384528 TCTGCTGGGAAAAGTAAAGCAGG + Intergenic
922135905 1:222826011-222826033 GAAACTTGGAAGGGTAAGGCAGG - Intergenic
922275818 1:224077082-224077104 GCAACTTGGAAGGCTAAGGCAGG + Intergenic
1062781263 10:210914-210936 GCACTTTGGAAGGCTAAAGCAGG + Intronic
1063356103 10:5399810-5399832 CCAGCTTGGAAGGCTCAAGTGGG - Intronic
1063954432 10:11253226-11253248 TGAGGTTGGAGGGTTAAAGCAGG - Intronic
1064154324 10:12891079-12891101 TCAGGTAGGAAGGGGGAAGCTGG + Intergenic
1064287001 10:14000398-14000420 GCAGTTTGGGAGGCTAAAGCGGG + Intronic
1064614118 10:17135027-17135049 TCTGCCTGGAAGGGGAATGCAGG + Intergenic
1065195988 10:23266076-23266098 TCATCTTGGAAAAGTAAAGGAGG + Intergenic
1065568637 10:27044038-27044060 GCACTTTGGAAGGCTAAAGCGGG - Intronic
1067417672 10:46117400-46117422 TCTGCCTGGAAAGGAAAAGCAGG + Intergenic
1069781718 10:70961213-70961235 TCAGCTATGATGGGGAAAGCTGG + Intergenic
1070619877 10:78001156-78001178 GCAGATTGGAAGGGTAAAACAGG + Intronic
1070840707 10:79485993-79486015 GCAGTTTGGAAGGCTGAAGCAGG + Intergenic
1071686750 10:87765924-87765946 TCTGCTTGGGAGGGTGAGGCGGG + Intronic
1071847317 10:89534559-89534581 TCACTTTGGGAGGCTAAAGCGGG + Exonic
1072083419 10:92055791-92055813 ACACCTTGGAAGGGTGAGGCAGG + Intronic
1072718349 10:97766197-97766219 GCAGCTTGGGAGGCTGAAGCGGG - Intergenic
1072829708 10:98644844-98644866 ACAGCTTGTAAGGGTAAAACTGG - Intronic
1074470607 10:113723243-113723265 TCAGCTTGTAAGAGTCAAGTTGG - Intronic
1074619635 10:115105892-115105914 TCAGTGTGGAAGGGAAAAGTGGG + Intronic
1075764620 10:124883492-124883514 GCTGCTTGGAAGGCTGAAGCAGG - Intergenic
1075862364 10:125687910-125687932 TCACCTTGTAAGGGTGAATCTGG + Intergenic
1075887906 10:125917834-125917856 ACATCTTGGAAGGATAAGGCGGG + Intronic
1077627209 11:3783143-3783165 ACAGCTTGGGAGGCTGAAGCGGG + Intronic
1078768476 11:14323344-14323366 ACAGCTTGGAAGGCTAAGGTAGG + Intronic
1080819439 11:35791185-35791207 TCAGCTTGGAAGAGTATTACAGG - Intronic
1081108479 11:39101775-39101797 TAAGTTTGGAAGGGTGAAACTGG + Intergenic
1081525649 11:43925753-43925775 TCAGCTAGAAAGGGCAGAGCTGG - Intronic
1081602216 11:44503420-44503442 TGAGCTTGGAAGGGCAAAGCTGG + Intergenic
1081879167 11:46433409-46433431 TAGGCTTGGAAGGGTAATGAGGG - Intronic
1082018297 11:47509440-47509462 GCAACTTGGAAGGATAAGGCAGG + Intronic
1082989653 11:59196514-59196536 TCAGCTAGGAAGGGGAACCCAGG - Intronic
1083646388 11:64173569-64173591 ACACCTTGGAAGGCTGAAGCAGG - Intergenic
1083787115 11:64957188-64957210 GCTGCTTGGAAGGCTAAGGCAGG - Intronic
1084197464 11:67531883-67531905 TCACTTTGGAAGGCTAAGGCAGG - Intergenic
1085242003 11:75064684-75064706 TCTGCTTGGGAGGCTGAAGCAGG - Intergenic
1085575821 11:77601594-77601616 ACACCTTGGAAGGCTGAAGCGGG - Intronic
1085815946 11:79737646-79737668 TCAGCTTTGAAAGGTAATGGGGG + Intergenic
1086102983 11:83120798-83120820 ACAGCTTGGGAGGCTGAAGCAGG - Intergenic
1086871216 11:92039142-92039164 TCAGGTTGGAAGGGAAAATGTGG + Intergenic
1088259489 11:107930329-107930351 TCAACTTAGAATGGTAAAACTGG - Intronic
1088682606 11:112256882-112256904 CCAGAATGGAAGGGAAAAGCAGG - Intronic
1090051800 11:123386547-123386569 GCTACTTGGAAGGGTAAGGCAGG - Intergenic
1090460077 11:126883262-126883284 GCAACTTGGAAAGGCAAAGCAGG + Intronic
1091782046 12:3220031-3220053 GCTGCTTGGAAGGCTAAGGCAGG + Intronic
1093649867 12:21630483-21630505 GCAACTTGGGAGGGTAAAGTGGG + Intergenic
1094560083 12:31544391-31544413 TCTGCTTGGAAGGCTGAGGCAGG - Intronic
1095736330 12:45560556-45560578 TCTATTTGGAAGGGTAAAGATGG - Intergenic
1098211606 12:68171951-68171973 TCAGGTTGGATTGGTAAATCTGG - Intergenic
1100134346 12:91537277-91537299 TTAGGATGCAAGGGTAAAGCAGG + Intergenic
1100459082 12:94780663-94780685 GCTACTTGGAAGGGTGAAGCAGG + Intergenic
1101185140 12:102268591-102268613 ACAGTTTGGAAGGCTAAGGCGGG + Intergenic
1101236372 12:102794222-102794244 GCAGCTTGAAGGGGTACAGCGGG + Intergenic
1102021721 12:109687939-109687961 GCACTTTGGAAGGTTAAAGCAGG - Intergenic
1108338096 13:49466900-49466922 TCACTTTGGAAGGATAAAGTGGG - Intronic
1108444230 13:50491266-50491288 GCTACTTGGAAGGGTGAAGCAGG - Intronic
1108518667 13:51224929-51224951 TCAGGTGGGAAGGGCAGAGCTGG - Intronic
1108709713 13:53020675-53020697 TCAGTTTGGGAATGTAAAGCTGG - Intergenic
1109384907 13:61615654-61615676 TCATCTTTGAAGTGTAAAGTTGG + Intergenic
1109470546 13:62799062-62799084 GCAGCTTGGGAGGCTGAAGCTGG - Intergenic
1110447217 13:75599215-75599237 GCACTTTGGAAGGCTAAAGCAGG - Intronic
1111676321 13:91394122-91394144 GCAGCTTGGGAGGCTAAAGTAGG - Intergenic
1112551922 13:100429276-100429298 TCTGCTTGGAGGTGTTAAGCTGG - Intronic
1113445922 13:110366731-110366753 TCATCTTCGAAGGGTGAAGATGG + Intronic
1113664467 13:112131712-112131734 TCAGCCTGCAAGAGCAAAGCAGG - Intergenic
1117844642 14:59897822-59897844 TCACTTTGGAAGGCCAAAGCAGG - Intergenic
1117895411 14:60480173-60480195 TTACTTTGGAAGGGTAAGGCAGG + Intronic
1118015870 14:61660227-61660249 GCACGTTGGAAGGGTAAGGCAGG - Intergenic
1118269369 14:64327958-64327980 GCACTTTGGAAGGGCAAAGCGGG + Intronic
1118838943 14:69496791-69496813 ACAGTTTGGAAGGCTGAAGCAGG - Intronic
1119641012 14:76314882-76314904 TCAGCTTGGAAAGGGAGGGCAGG + Intronic
1121205265 14:92159573-92159595 TCAGCTTAGAAGGCTGAGGCAGG + Intronic
1122133426 14:99619214-99619236 TCAGCTTGGGAGGCTGAGGCAGG + Intergenic
1202870243 14_GL000225v1_random:156221-156243 ACATCTTGGAAGGATAAGGCGGG - Intergenic
1124202049 15:27686950-27686972 TGAGCTTGGAATAGTAAAACTGG + Intergenic
1124211081 15:27765604-27765626 ACAGCTTAGAAGGTTATAGCTGG + Intronic
1124810693 15:32935165-32935187 GCACTTTGGAAGGGTAAGGCAGG - Intronic
1126495252 15:49283000-49283022 TTAGGATAGAAGGGTAAAGCAGG - Intronic
1126639306 15:50808685-50808707 TCAACTTGGATGGGTTTAGCAGG + Intergenic
1126723283 15:51605445-51605467 GCAGTTTGGAAGGCCAAAGCAGG - Intronic
1127732512 15:61813779-61813801 ACTGCTGGGGAGGGTAAAGCAGG + Intergenic
1128080656 15:64855082-64855104 TCAGCTTGGGAGGCCTAAGCAGG + Intronic
1129752197 15:78073855-78073877 TCAGCTCGGAAGGCTGAGGCAGG + Intronic
1131155096 15:90069975-90069997 TCAGCTTTGAAGGGTAAAGTTGG - Intronic
1133738326 16:8632450-8632472 GCACTTTGGAAGGCTAAAGCAGG - Intronic
1133926197 16:10194541-10194563 ACAGCTTGGGAGGCCAAAGCAGG + Intergenic
1135686189 16:24500099-24500121 AGAGCTTGTAGGGGTAAAGCTGG + Intergenic
1136560489 16:31036226-31036248 GCATCTTGGAAGGGTGAAGCTGG + Intronic
1137600585 16:49753489-49753511 GCTACTTGGAAGGCTAAAGCAGG + Intronic
1139554818 16:67700598-67700620 GCTGCTTGGAAGGGTGAGGCAGG + Intronic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1140058995 16:71551190-71551212 GCACCTTGGAAGACTAAAGCAGG + Intronic
1140850993 16:78934395-78934417 GCTACTTGGAAGGCTAAAGCAGG + Intronic
1141457782 16:84155474-84155496 GCACTTTGGAAGGCTAAAGCGGG - Intronic
1142186369 16:88696673-88696695 TCAGCTTTGAAGGTGACAGCGGG + Exonic
1144472335 17:15556026-15556048 GCAACTTGGAAGGCTGAAGCAGG - Intronic
1144813061 17:18014042-18014064 TCTACTTGGAAGGCTAAGGCAGG - Intronic
1144924142 17:18788668-18788690 ACAACTTGGAAGGCTGAAGCAGG + Intronic
1146046346 17:29511652-29511674 GCTACTTGGAAGGCTAAAGCAGG - Intronic
1147025858 17:37582612-37582634 GCACTTTGGAAGGCTAAAGCAGG + Intronic
1147197451 17:38777006-38777028 GCACCTTGGAAGGGTGAGGCAGG - Intronic
1147351415 17:39848927-39848949 CCACTTTGGGAGGGTAAAGCGGG - Intronic
1148581022 17:48743811-48743833 TCAGCTTAGAAGGGTAAAGCAGG - Intergenic
1148770975 17:50066138-50066160 TTAGCTTGGGAGGCTAAGGCTGG - Intronic
1148837007 17:50470616-50470638 TCAGCTTGGAAGGGAGGAGCCGG + Intronic
1149391489 17:56196018-56196040 TCACCTTGGAAGGCTGAGGCAGG + Intronic
1150042518 17:61879164-61879186 GCACCTTGGAAGGCCAAAGCAGG - Intronic
1150584944 17:66508984-66509006 TTAGCTTGGGAGGGTAGTGCAGG + Intronic
1152045738 17:77934190-77934212 TCAGCTTGGAAATTTACAGCTGG - Intergenic
1154360277 18:13654997-13655019 TTAGCATGAAAGGGTAAAGTTGG - Intergenic
1155967942 18:32053529-32053551 GCACTTTGGAAGGCTAAAGCAGG + Intronic
1156559280 18:38103850-38103872 TCAACTGGAAAGGGTAAAGTAGG + Intergenic
1157399731 18:47377463-47377485 TCAGCTTAGAAGGGAAAACAGGG + Intergenic
1159025271 18:63177789-63177811 TCAGCTTGGAAGCTTCAGGCAGG - Intronic
1159090624 18:63844627-63844649 CCAGCTTGGAAGGGCAGAGGAGG - Intergenic
1159091440 18:63853639-63853661 TGAGGTTGGAAGAGTAAAGATGG - Intergenic
1161856476 19:6768429-6768451 GCTGCTTGGAAGGCTGAAGCGGG - Intergenic
1162087422 19:8257090-8257112 GCAGCTGGGAAGGGTCAGGCAGG - Intronic
1162456759 19:10789720-10789742 GCTACTTGGAAGGCTAAAGCAGG + Intronic
1162684917 19:12374395-12374417 GCACCTTGGAAGGCCAAAGCAGG - Intergenic
1162755470 19:12856412-12856434 GCTGCTTGGAAGGCTGAAGCAGG - Intronic
1162917642 19:13882846-13882868 GCCCCTTGGAAGGGTAAGGCAGG + Exonic
1163557151 19:17999306-17999328 GCACTTTGGGAGGGTAAAGCGGG + Exonic
1164079193 19:21848064-21848086 TCAGTTTGGAAGGCTGAGGCGGG - Intronic
1164690565 19:30208034-30208056 TCTACTTGGGAGGGTAAGGCAGG - Intergenic
1166023524 19:40055832-40055854 GCAGCTTTGAAGGGGAAAGACGG + Intronic
1166315857 19:41989184-41989206 ACAGTTTGGGAGGCTAAAGCAGG - Intronic
1167070067 19:47216515-47216537 GCTACTTGGGAGGGTAAAGCAGG - Intergenic
1167303035 19:48690499-48690521 GCTGCTTGGGAGGGTGAAGCAGG - Intergenic
1168553939 19:57322410-57322432 CCAGCTTGGGAGGCTAAGGCAGG + Intronic
927277390 2:21273401-21273423 TCAGCTTGTACGAGTAAAGCAGG - Intergenic
927434498 2:23055410-23055432 TAGACTTGGAAGGGTTAAGCTGG + Intergenic
927721461 2:25385606-25385628 GCAGCTTGAAGGGGGAAAGCTGG - Intronic
928114493 2:28537389-28537411 TCACATTGAAAAGGTAAAGCAGG + Intronic
929876680 2:45802156-45802178 GCTGCTTGGAAGGGTGAGGCAGG + Intronic
930703182 2:54479939-54479961 TTTGCTTGGAAGGCTGAAGCAGG - Intronic
931717888 2:65043615-65043637 TAGGCATGGAAGTGTAAAGCTGG - Intergenic
931764447 2:65442396-65442418 GCTGCTTGGGAGGCTAAAGCAGG + Intergenic
932300886 2:70666329-70666351 TCAGCTTAGAAGGCTCAGGCTGG - Intronic
932371150 2:71189125-71189147 CCAGCTTGGAAGGCTAAAGCAGG - Intronic
932467721 2:71934265-71934287 TCAGCTTGGAAAGAAAAGGCAGG - Intergenic
932819190 2:74885153-74885175 ACAGCTTGGAAGAGAGAAGCAGG - Intronic
936131988 2:109852636-109852658 TTAGCTTAGGAGGGTAAAGTAGG + Intronic
936212709 2:110518849-110518871 TTAGCTTAGGAGGGTAAAGTAGG - Intronic
937064268 2:119005481-119005503 ACAGCTAGGAAGGGCAGAGCTGG + Intergenic
939992720 2:148890387-148890409 TCTGCTTGGGAGGCTGAAGCAGG + Intronic
940124165 2:150305133-150305155 GCGGCTTGGAAGGCTGAAGCAGG - Intergenic
941064196 2:160882408-160882430 GCTACTTGGAAGGTTAAAGCGGG + Intergenic
941081662 2:161068432-161068454 TCTTCTTGGAAGCTTAAAGCAGG + Intergenic
944907406 2:204276287-204276309 TCAGCTTGGAAGGGTAAAGCAGG - Intergenic
945476691 2:210291372-210291394 GCTGCTTGGGAGGCTAAAGCAGG - Intronic
946979739 2:225196590-225196612 TCAGTTTGGCAAGGTATAGCAGG - Intergenic
947215944 2:227750012-227750034 CCTGCTTGGGAGGCTAAAGCAGG - Intergenic
948037082 2:234866311-234866333 TAAGCTTTGAAGGGCAAAGATGG - Intergenic
948785114 2:240348242-240348264 TCTGCATGGAAGGGTCAGGCTGG - Intergenic
1169615446 20:7438325-7438347 TCATCTTGGAAGGCTGAGGCAGG - Intergenic
1170096982 20:12656784-12656806 TCAACTTGGAAATGGAAAGCAGG + Intergenic
1170626661 20:18035202-18035224 GCACTTTGGAAGGGTAAGGCAGG + Intronic
1170769554 20:19320015-19320037 GCAGCATGGATGGGGAAAGCTGG + Intronic
1172925327 20:38528926-38528948 GCACTTTGGAAGGGTAAGGCAGG - Intronic
1173497672 20:43531020-43531042 TCAGATGGGAGGGGTACAGCTGG + Intronic
1174690170 20:52496362-52496384 TCAGCTTCGTGGGCTAAAGCAGG - Intergenic
1175523595 20:59618577-59618599 TCAGCTTGGAAGGGAAGGGCAGG + Intronic
1177816197 21:25979888-25979910 CCAGCTTGGAAAGATAATGCAGG + Intronic
1178006043 21:28220341-28220363 TCAGCTGCCAATGGTAAAGCAGG - Intergenic
1180934487 22:19615945-19615967 TCTGCTTGGAAGGCTGAGGCAGG - Intergenic
1181688206 22:24543552-24543574 GCAGCATGAAAGGGTAAGGCAGG + Intronic
1182171912 22:28239337-28239359 TCAGCTTGGAAATATAAAACTGG + Intronic
1182879887 22:33724298-33724320 TCAGATGGGAAGGGTGAAGGAGG + Intronic
1184248984 22:43249635-43249657 TGAGCCTGGCAGGGTGAAGCAGG + Intronic
1184353509 22:43961559-43961581 ACTACTTGGAAGGGTAAGGCAGG - Intronic
949565064 3:5237004-5237026 TCAGAGTGGAAGGGCAAAGTTGG - Intergenic
950073554 3:10171270-10171292 ACAGCTGGGCAGGGCAAAGCAGG - Intronic
953471250 3:43168782-43168804 ACAGCTAGGAAGGGGGAAGCTGG - Intergenic
954061416 3:48070911-48070933 TCAACTTGGTAGGCTAAGGCAGG + Intronic
954583605 3:51716828-51716850 TCAGCTTGGGAGTGCAGAGCAGG + Intronic
958104782 3:89057868-89057890 GCTACTTGGAAGGCTAAAGCAGG - Intergenic
959155318 3:102659627-102659649 GCAGTTTGGAAGGCCAAAGCAGG - Intergenic
959634178 3:108543633-108543655 TCAGCTTAGAAGAGTTAAGGTGG - Intergenic
960791540 3:121436913-121436935 TCATCTTGGAAGAGTAGAGAAGG + Intronic
961251149 3:125506696-125506718 GCAGCTTGGAAGGCTGAGGCAGG - Intronic
962419466 3:135215407-135215429 GCAGCTTGGGAGGCTAAGGCAGG - Intronic
963132801 3:141874291-141874313 GCTACTTGGAAGGGTGAAGCAGG + Intergenic
963828154 3:149978094-149978116 TCAGCCTGAAATGGTAAAGTGGG - Intronic
964624802 3:158748780-158748802 ACAGCCAGGAAGGGTAGAGCTGG + Intronic
969077463 4:4591432-4591454 TCAGCTTTGAAGGATGAAGCTGG + Intergenic
970462769 4:16292245-16292267 CCAGCTTTGAATGGTAAGGCAGG - Intergenic
971354907 4:25886623-25886645 TCAGCTTGGATGAGTTGAGCTGG - Intronic
971960844 4:33485259-33485281 ACAGCCAGGAAGGGCAAAGCTGG + Intergenic
972302796 4:37801159-37801181 GCACTTTGGAAGGCTAAAGCAGG + Intergenic
972641642 4:40930991-40931013 GCAGTTTGGGAGGGTAAGGCAGG - Intronic
973738000 4:53891378-53891400 TCAGCTCAGCAGGGGAAAGCCGG + Intronic
975608947 4:76184914-76184936 GCAGCTTGGAAGACAAAAGCAGG - Intronic
981361482 4:143850680-143850702 GCAGCTTGGAAAGGTCAGGCTGG + Intergenic
982573061 4:157075007-157075029 CCAGCTTGGGAGGCTAAGGCAGG + Intergenic
984532209 4:180930786-180930808 GCAGTTTGGGAGAGTAAAGCTGG + Intergenic
985817318 5:2136489-2136511 TCAGCTCTGAAAGGAAAAGCTGG - Intergenic
986833907 5:11612786-11612808 TCAACTTGGGAGGTTAAGGCGGG + Intronic
986905200 5:12487343-12487365 TCAGCTGGGCAGGGTAAAGGAGG - Intergenic
988511304 5:31866948-31866970 TCACCTTCGAAGGATGAAGCTGG - Intronic
988566641 5:32324372-32324394 GCACCTTGGAAGGCTGAAGCAGG - Intergenic
988789921 5:34598229-34598251 TCAGCCTGGAACTGCAAAGCAGG - Intergenic
993975083 5:94469416-94469438 GCACTTTGGAAGGGTAAGGCAGG - Intronic
995657837 5:114446788-114446810 TCTACTTGGAAGGCTGAAGCAGG + Intronic
996741161 5:126800327-126800349 TCTGCTAGGAGAGGTAAAGCAGG + Intronic
997318299 5:132956382-132956404 GCACCTTGGAAGGCTAAGGCAGG + Intronic
998393485 5:141803168-141803190 TCAGGTGGGAAGGGTGAGGCAGG - Intergenic
998620988 5:143793946-143793968 GCAACTTGGGAGGCTAAAGCAGG + Intergenic
998758813 5:145409665-145409687 GCAGTTTGGAAGGGCAAGGCGGG + Intergenic
999140879 5:149360810-149360832 GCATCTTGGGAGGGTAAAGCAGG + Intronic
999273214 5:150310334-150310356 ACAGCTAGGAAGGGTGGAGCTGG - Intronic
999691720 5:154152147-154152169 GCTACTTGGAAGGCTAAAGCGGG + Intronic
1000305935 5:159994726-159994748 TCAGCATGGAAAGGGACAGCAGG + Intergenic
1002944656 6:1749941-1749963 TCTACTTGGAAGGCTGAAGCTGG - Intronic
1003640945 6:7874507-7874529 GCACCTTGGGAGGCTAAAGCAGG + Intronic
1004011783 6:11696034-11696056 GCTACTTGGGAGGGTAAAGCAGG - Intergenic
1004305442 6:14497940-14497962 GCAGCTTGGAATGGAAGAGCTGG + Intergenic
1004369338 6:15038614-15038636 CCAGCTTGGAAGGCAGAAGCAGG - Intergenic
1004760796 6:18663958-18663980 TCAGCATGGAAAGGAACAGCTGG - Intergenic
1004842428 6:19602612-19602634 TCAGCTTGGAAGGCTTCAGTGGG + Intergenic
1007037993 6:38695628-38695650 TCACCTTGGCAGGGGAAGGCTGG + Intronic
1007093847 6:39201213-39201235 GCAGCTGGGAATGGTAAAGGAGG - Intronic
1007422195 6:41726553-41726575 CCAGCTTGGGAGGCTAAGGCAGG - Intronic
1007496991 6:42267076-42267098 TCACTTTGGGAGGCTAAAGCAGG + Intronic
1008612244 6:53195270-53195292 TCACTTTGGAAGGCTGAAGCAGG + Intergenic
1008656418 6:53618631-53618653 TCACCTTGGAAGGCTGAAGGAGG - Intergenic
1011579687 6:88846499-88846521 GCACTTTGGAAGGCTAAAGCGGG + Intronic
1013036908 6:106393785-106393807 CCAGCTTGGAAGGCTGAAGCAGG - Intergenic
1013522699 6:110947527-110947549 TCTACTTGGAAGGGTGAAGCAGG - Intergenic
1013722363 6:113045759-113045781 TCAGATTGGCATGGTAAAACAGG + Intergenic
1014921403 6:127218042-127218064 TCAGTTTGGAAGGCCAAAGTGGG - Intergenic
1016152397 6:140758013-140758035 TCAGCTTTGCAGAGAAAAGCAGG + Intergenic
1016670873 6:146706034-146706056 GCTGCTTGGGAGGGTAAGGCAGG - Intronic
1017568024 6:155709591-155709613 TTAGCTGGGAGGGGGAAAGCTGG - Intergenic
1019363357 7:617414-617436 TCTGCTTGGGAGGCTAAGGCAGG - Intronic
1019937454 7:4265715-4265737 CCAACTAGGAAGGGTCAAGCGGG + Exonic
1020084044 7:5301010-5301032 GCACTTTGGAAGGGCAAAGCGGG + Intronic
1021302851 7:18993553-18993575 GCATTTTGGAAGGCTAAAGCAGG + Intronic
1021742176 7:23697861-23697883 CCTACTTGGAAGGGTAAAGCAGG - Intronic
1022269450 7:28792056-28792078 GCACCTTGGAAGGCTAAGGCAGG + Intronic
1022716510 7:32903756-32903778 CCAGCTTGGAAGGCTGAGGCAGG - Intergenic
1023365431 7:39458790-39458812 TCAGGTTGGTAGGGTGAAGCAGG - Intronic
1023482321 7:40647074-40647096 GCAGCTTGACAGGGCAAAGCAGG + Intronic
1024345047 7:48304890-48304912 TCACACTGGAAGGGTAAAACAGG - Intronic
1026928791 7:74211386-74211408 GCTACTTGGAAGGGTAAGGCAGG - Intronic
1029508160 7:100975337-100975359 TTAGCTTAGAAAGGTGAAGCTGG + Intronic
1031925183 7:127632156-127632178 CCAGCTAAGTAGGGTAAAGCAGG - Intergenic
1032393925 7:131575479-131575501 TCAGCCTGGGAGGGCAAGGCTGG + Intergenic
1032633628 7:133682013-133682035 CCAGCTTGGGAGGCTAAGGCCGG - Intronic
1033129835 7:138736132-138736154 GCTGCTTGGAAGGCTGAAGCAGG + Intronic
1033357847 7:140615111-140615133 GCACTTTGGAAGGGCAAAGCAGG - Intronic
1033503071 7:141973326-141973348 TGAGCTTGGAGCAGTAAAGCAGG + Exonic
1033511610 7:142065313-142065335 TCTGCTTGGAAGGGAACAGGAGG - Exonic
1034407123 7:150912122-150912144 TCACCTTGGAGGAGAAAAGCGGG + Intergenic
1035023637 7:155813148-155813170 TCAGGGTGGATGGGCAAAGCAGG + Intergenic
1035259055 7:157650150-157650172 CCAGCAGGGAAGGGGAAAGCTGG - Intronic
1037944330 8:22977331-22977353 TCAATTTGGGAGGGTAAGGCAGG + Intronic
1038661297 8:29499303-29499325 TGAACTTGGAAGAGAAAAGCAGG + Intergenic
1040531096 8:48266968-48266990 TCAACTTAGGAGGGTAGAGCAGG - Intergenic
1040931897 8:52743998-52744020 TAGGCTTGCAAGGGTGAAGCAGG + Intronic
1041463165 8:58133584-58133606 TCAGCTTGGAAGACTCAAGGAGG + Intronic
1041924095 8:63218291-63218313 GCACCTTGGGAGGGTAAGGCAGG - Intergenic
1043785825 8:84398725-84398747 TCACTTTGGAAGGCCAAAGCGGG + Intronic
1044566168 8:93663000-93663022 GCACTTTGGAAGGCTAAAGCAGG - Intergenic
1047383457 8:124386044-124386066 TCACCTTGGAAGGTTGAATCAGG + Intergenic
1048743956 8:137592408-137592430 ACAGCTTGAAAGGGCAGAGCTGG - Intergenic
1050209559 9:3238256-3238278 TAAGAATGGAAGGGTAAAGTGGG + Intronic
1050526177 9:6548793-6548815 TCACCCTGGAAGGGAAAGGCTGG - Intronic
1051126531 9:13811594-13811616 TCAGGGTGGGAGGGTAAAGTGGG - Intergenic
1053855838 9:42338267-42338289 CCAGCTTTGAAGGGAAAAGAAGG + Intergenic
1053877695 9:42560660-42560682 GCACTTTGGAAGGGTGAAGCAGG + Intergenic
1054233999 9:62541034-62541056 GCACTTTGGAAGGGTGAAGCAGG - Intergenic
1058550197 9:106106567-106106589 TCACTTTGGTAGGGTAAGGCAGG + Intergenic
1059817353 9:117932275-117932297 TCAGTTTGGAAGGCTGAGGCAGG - Intergenic
1062200138 9:135298477-135298499 GCACTTTGGAAGGTTAAAGCGGG - Intergenic
1203734209 Un_GL000216v2:120358-120380 ACATCTTGGAAGGATAAGGCGGG + Intergenic
1187125427 X:16449908-16449930 TCTGCTTGGAAGTCTAAAGAGGG - Intergenic
1188377088 X:29444460-29444482 GCACTTTGGGAGGGTAAAGCGGG + Intronic
1191762691 X:64662405-64662427 TCACCTGGGAAGTGCAAAGCAGG - Intergenic
1192111591 X:68370393-68370415 TCTACTTGGGAGGCTAAAGCAGG + Intronic
1193101799 X:77622703-77622725 GCAGCTTGGAGGTGGAAAGCCGG + Intronic
1193434162 X:81451259-81451281 TAAGCATGGAAAGGTAAAACTGG + Intergenic
1194791753 X:98159595-98159617 GCATCTTGCAAGGATAAAGCAGG + Intergenic
1194948431 X:100095715-100095737 GCTGCTTGGAAGGCTAAAGCAGG + Intergenic
1195667200 X:107442132-107442154 TCAGCTTTGAAAGGAAAAACAGG - Intergenic
1196735455 X:118977436-118977458 TCCTCTTAGAAGGGTAAAGCTGG - Intronic
1198019590 X:132644918-132644940 ACAACTTGTAAGGGTAAAGGAGG + Intronic
1198433543 X:136591816-136591838 GCACCTTGGAAGGCTGAAGCAGG + Intergenic
1198964706 X:142215185-142215207 TCAGCTAGGATGGCTAAAGGAGG - Intergenic
1199356538 X:146869239-146869261 TCACCTTCCAAGGGTAAAGAGGG - Intergenic
1199739551 X:150720757-150720779 TCAAATTGGAAGGGAAAAACTGG - Intronic
1200270009 X:154673873-154673895 TCTGTTTGGGAGAGTAAAGCTGG + Intergenic
1201677193 Y:16599767-16599789 GCAGTTTGGAAGGCTAAAGTGGG - Intergenic
1202626805 Y:56868068-56868090 ACATCTTGGAAGGATAAGGCAGG - Intergenic