ID: 944908886

View in Genome Browser
Species Human (GRCh38)
Location 2:204289935-204289957
Sequence CTGGACAAAACATTCTTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944908886_944908890 23 Left 944908886 2:204289935-204289957 CCAAACAAGAATGTTTTGTCCAG No data
Right 944908890 2:204289981-204290003 ACTTATTTCAAGAGCATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944908886 Original CRISPR CTGGACAAAACATTCTTGTT TGG (reversed) Intergenic
No off target data available for this crispr