ID: 944909138

View in Genome Browser
Species Human (GRCh38)
Location 2:204292168-204292190
Sequence TTGTCCCTATGTAAGATTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 2, 2: 4, 3: 19, 4: 181}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944909138_944909143 21 Left 944909138 2:204292168-204292190 CCATAAATCTTACATAGGGACAA 0: 1
1: 2
2: 4
3: 19
4: 181
Right 944909143 2:204292212-204292234 TCTTTTAAAAGGCAAGAAAATGG 0: 1
1: 0
2: 14
3: 146
4: 1128
944909138_944909144 22 Left 944909138 2:204292168-204292190 CCATAAATCTTACATAGGGACAA 0: 1
1: 2
2: 4
3: 19
4: 181
Right 944909144 2:204292213-204292235 CTTTTAAAAGGCAAGAAAATGGG 0: 1
1: 0
2: 4
3: 105
4: 934
944909138_944909141 10 Left 944909138 2:204292168-204292190 CCATAAATCTTACATAGGGACAA 0: 1
1: 2
2: 4
3: 19
4: 181
Right 944909141 2:204292201-204292223 ACAGCTTCCAGTCTTTTAAAAGG 0: 1
1: 0
2: 2
3: 20
4: 238
944909138_944909145 30 Left 944909138 2:204292168-204292190 CCATAAATCTTACATAGGGACAA 0: 1
1: 2
2: 4
3: 19
4: 181
Right 944909145 2:204292221-204292243 AGGCAAGAAAATGGGAAAGATGG 0: 1
1: 2
2: 8
3: 158
4: 1479

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944909138 Original CRISPR TTGTCCCTATGTAAGATTTA TGG (reversed) Intergenic
900753885 1:4419826-4419848 TTGGCCCAATGTAATCTTTAGGG + Intergenic
901350929 1:8595873-8595895 TTGTGCCTGTGTAAGGTTTGAGG - Intronic
901460610 1:9389025-9389047 CTGTCCCTGGGGAAGATTTATGG + Intergenic
906028240 1:42694231-42694253 TTCTCCCTAAGTATCATTTAGGG + Intronic
910766618 1:90788868-90788890 TGCTCCCTTTGTTAGATTTATGG + Intergenic
910774291 1:90859870-90859892 GTGTCCCTTTTTAAGACTTAAGG + Intergenic
910848712 1:91629540-91629562 TTGTCTCTGTGTAAATTTTAGGG - Intergenic
911386372 1:97180182-97180204 TTGTCCTCATCTAAGATTTCAGG - Intronic
911815127 1:102339853-102339875 ATGTCGCTATATAAAATTTAAGG + Intergenic
912653007 1:111457704-111457726 TTGTCCCTTTCCAAGACTTATGG + Intronic
917086636 1:171310848-171310870 TTGTCACTTTGTAAGCTTTGGGG - Intergenic
922020625 1:221700712-221700734 TTGGCCATAAGGAAGATTTATGG - Intergenic
924068122 1:240247139-240247161 TTGTTCCTATGTAAAATCTTAGG + Intronic
924379717 1:243451237-243451259 TTGTGCCTATGAAATCTTTAGGG - Intronic
1066614050 10:37278629-37278651 TTGTCACTCTGTAAGCTTTGGGG + Intronic
1068500836 10:57838698-57838720 TTGTCACTCTGTAAGCTTTGGGG - Intergenic
1070459821 10:76653695-76653717 TTGTCACTGTGTAAAAATTAGGG - Intergenic
1071282815 10:84118130-84118152 TTGTCACTATGCAGGATTTATGG - Intergenic
1071424681 10:85537223-85537245 TTGTCACTATGTAGGATTTATGG - Intergenic
1072246465 10:93548017-93548039 TTGTCACTATGTAGGATTTATGG + Intergenic
1072371125 10:94767353-94767375 TTGTCACTCTGTAAGCTTTGGGG + Intronic
1072510789 10:96122431-96122453 TTTTCTCTCTGTAAGATTTTAGG + Intergenic
1073850624 10:107613184-107613206 TTGTCATTATAAAAGATTTATGG - Intergenic
1073893595 10:108127989-108128011 TACTCCCTAAGGAAGATTTATGG - Intergenic
1074482148 10:113833921-113833943 TTTTCACTTTGTAATATTTAAGG - Intergenic
1075984887 10:126776410-126776432 TTGTCACTATAGAAGATTTATGG + Intergenic
1076125493 10:127970789-127970811 TTGTTACTATGGAAGATTTTAGG + Intronic
1079835713 11:25329805-25329827 TAGTCCCTTTGCAAGATTGAGGG + Intergenic
1079900376 11:26175635-26175657 TAGACTCTATGTAGGATTTAAGG + Intergenic
1079917667 11:26390859-26390881 TTGTCCCTAGATAAAAATTAGGG + Intronic
1080370106 11:31628190-31628212 TTGGCCCTACCTAAGATTTATGG + Intronic
1081041457 11:38219704-38219726 TAGTCACTTTGTAAGATTTTGGG + Intergenic
1082625085 11:55474670-55474692 CTGTGCCTATTTAAGATTCAAGG - Intergenic
1089548482 11:119250277-119250299 TTGTCCTTGTGTGAGATCTAGGG + Intronic
1094227292 12:28060321-28060343 TTGTCCTGATTTAATATTTATGG - Intergenic
1094569737 12:31631192-31631214 TTGTCACTATGTAGGATTTATGG + Intergenic
1095980628 12:47972484-47972506 GTGTCCCTCTGTAAGACTTTTGG - Intergenic
1099234678 12:80069613-80069635 TTGGTCATATGTTAGATTTATGG - Intergenic
1099350039 12:81555328-81555350 TTGTCCCAATTTAAGACATATGG + Intronic
1100122200 12:91381974-91381996 TTTTCTCTTTGTGAGATTTAAGG - Intergenic
1100529680 12:95452003-95452025 TTGTTGCTTTGTAAGCTTTAGGG + Intergenic
1100778487 12:97998396-97998418 TTGTCCCTAAGTAGGTTTTTGGG - Intergenic
1101780303 12:107829100-107829122 TTGTCACTCTGTAAGCTTTGGGG + Intergenic
1104306699 12:127616238-127616260 TTGTCACTCTGTAAGCTTTGGGG - Intergenic
1105532634 13:21233500-21233522 TTGTCCCTAAGTCATATTTAGGG - Intergenic
1106571092 13:30928727-30928749 TTGTCCAAATGTAAGAGTGAAGG + Intergenic
1108864700 13:54909132-54909154 TTTTCCTTGTGTAAGATTTTTGG - Intergenic
1110085935 13:71379795-71379817 TTTCCCCTATGTAACATTCAGGG - Intergenic
1110275455 13:73637416-73637438 TTGTCCCTATTTTAGAGCTAAGG - Intergenic
1111736257 13:92143112-92143134 TTGTCCCTATTATAGATTTGAGG + Intronic
1112181428 13:97085284-97085306 TTTTAGCTGTGTAAGATTTAAGG - Intergenic
1113088818 13:106595983-106596005 TTTTCCGTATGTAATATTTTTGG + Intergenic
1116697891 14:48200489-48200511 TTGTCACTCTGTAAGCTTTGCGG - Intergenic
1117828286 14:59726317-59726339 TTGTCCCTAAGCAAGACTGAAGG - Intronic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1118127428 14:62923025-62923047 TTTTCTGTATATAAGATTTATGG - Intronic
1118658510 14:67980780-67980802 TTCTCCCTATGTATTCTTTAAGG - Intronic
1118954617 14:70468753-70468775 TTGTACTCATGTAAGATTTGGGG - Intergenic
1119462849 14:74824235-74824257 TTCTCTCTGTGTACGATTTAGGG + Exonic
1126166513 15:45658579-45658601 TTGTCCATCCGTAAGATCTAGGG - Intronic
1126415761 15:48416127-48416149 TGGTCCGTAGCTAAGATTTAGGG + Intronic
1127204562 15:56700631-56700653 TTGTCATTATGCAATATTTATGG + Intronic
1127248247 15:57202164-57202186 TTGGCCCTATGTGTGATTTTTGG - Intronic
1138871929 16:60900731-60900753 TTGTCCTTATCTAACATTTCTGG - Intergenic
1139048319 16:63090802-63090824 TTGCCCATATGTAAGCTTTTGGG - Intergenic
1140872958 16:79123541-79123563 TTGTCCTTATGTAAGGATTAAGG + Intronic
1144420903 17:15097723-15097745 TTATCCCTATTTTACATTTAAGG + Intergenic
1145822682 17:27851774-27851796 TTGTACATATTTAAGATGTACGG + Intronic
1146091238 17:29880587-29880609 TTGGGCCTATATAAGACTTAGGG - Intronic
1153763302 18:8352293-8352315 TTGTCTTTATTTTAGATTTAGGG + Intronic
1157786070 18:50483753-50483775 GTGTCCATACCTAAGATTTATGG - Intergenic
1158576517 18:58643297-58643319 TAGTCCCTTTGTAAGAGTGAGGG + Intergenic
1159194176 18:65090064-65090086 TTGTCCTTATCTAACATTTTAGG + Intergenic
1159611898 18:70535083-70535105 TTGTTCCTATGTTATATTTAAGG + Intergenic
1162236908 19:9316646-9316668 TTGTCGCTTTGTAAGCTTTGGGG + Intergenic
1163944175 19:20520705-20520727 TAGTCCCTTTGCAAGATTGAGGG + Intergenic
1164081133 19:21862292-21862314 TAGTCCCTTTGTAAGAATGAGGG - Intergenic
1164687909 19:30181415-30181437 TTATACCTATGTAAAATATATGG + Intergenic
1164870413 19:31638804-31638826 TTGTCATTATGTAAGATTCCAGG + Intergenic
925785704 2:7430163-7430185 TTGTCCCTAGATGAAATTTAAGG - Intergenic
927007367 2:18864650-18864672 GTGTCCCTATTTAAAATATATGG + Intergenic
929482880 2:42328229-42328251 TTGAAACTATGGAAGATTTAAGG - Intronic
934894989 2:98109760-98109782 TTCACCAGATGTAAGATTTAGGG + Intronic
939095500 2:137828905-137828927 TTGTTACTATATAGGATTTATGG + Intergenic
940672071 2:156682816-156682838 CTGTCACTTTGTAAGATCTATGG - Intergenic
942723044 2:178974070-178974092 TCTTTCCTATGTAAGATTAAAGG - Intronic
942911215 2:181246518-181246540 TTGTCCCGAGGAAAGAATTAAGG - Intergenic
943007611 2:182404750-182404772 TTGTCCCCATGGAAGTTTTTTGG + Intronic
943496551 2:188628403-188628425 TTGTCACTATATAGTATTTATGG - Intergenic
944251371 2:197582609-197582631 TTGTCCCTTTGCAAGAGTGAGGG - Intronic
944909138 2:204292168-204292190 TTGTCCCTATGTAAGATTTATGG - Intergenic
946206273 2:218111180-218111202 TTGTCACTCTGTAAGCTTTGGGG + Intergenic
1169894661 20:10489969-10489991 TTTTACCTATGAAAGATGTATGG - Intronic
1170396353 20:15930259-15930281 TTGTCCTTATCAAAGACTTACGG + Intronic
1171178120 20:23070228-23070250 TTGTCACTACATAGGATTTATGG + Intergenic
1171294260 20:24003915-24003937 TTGTCACTAAATAGGATTTATGG + Intergenic
1177135580 21:17302830-17302852 TTGTCACTTTGTAAGTTTTGGGG - Intergenic
1179214956 21:39359536-39359558 TTGTCCCTCTGCAAACTTTAGGG + Intergenic
949766128 3:7528481-7528503 TTGATCCTATGTATGATTTTTGG + Intronic
953713284 3:45293436-45293458 TTGTCCTTATATAAGATGTATGG - Intergenic
957108489 3:75923038-75923060 CTTGCCTTATGTAAGATTTAGGG - Intronic
958060500 3:88473933-88473955 TTGCCCCTGCCTAAGATTTATGG + Intergenic
963126197 3:141819236-141819258 TTGTCCCTCTGCCAGCTTTAAGG - Intergenic
964275105 3:155001128-155001150 TTGACCCTAGGTAAGGTGTAGGG + Intergenic
964970061 3:162549269-162549291 TTGACCATATGAATGATTTATGG - Intergenic
965108872 3:164395179-164395201 TTGTCACTATATAGAATTTATGG - Intergenic
965327166 3:167321046-167321068 TTGTCCCTATGTAAGTTTCCTGG + Intronic
965423721 3:168495828-168495850 TTGTCTCTATGTAGCTTTTATGG + Intergenic
966961777 3:184947028-184947050 TTGTCACTATGTAAGATTTAAGG - Intronic
966962841 3:184957803-184957825 TTGTCACTATGTAAGATTTAAGG - Intronic
971365643 4:25974940-25974962 TTGTCACTAGATAGGATTTATGG - Intergenic
971573668 4:28246480-28246502 TTGTCCATATGAAAGGTTTCAGG - Intergenic
971752120 4:30663531-30663553 TTTTCCCACTGTAAGGTTTAAGG - Intergenic
973538675 4:51911273-51911295 TTCTGCCTATGTAGGAATTACGG + Intronic
974014510 4:56636535-56636557 TTGTCACTGTGTAGGATTTATGG - Intergenic
974770806 4:66409822-66409844 TTTTCCTGATGTAAAATTTAAGG + Intergenic
976269691 4:83218466-83218488 TAGACCTTATGTAAGATTTGAGG + Intergenic
976731641 4:88267774-88267796 TTGTCACTATGCAGGATCTATGG + Intronic
977743307 4:100513727-100513749 TTGTCCTTATGAAAAAGTTATGG - Intronic
977884693 4:102242095-102242117 TTGTCACTCTGTAAGCTTTGGGG - Intergenic
979089287 4:116459636-116459658 TTGTGCCTATGTAATTTTTTTGG + Intergenic
979235781 4:118398612-118398634 TTGTCACTACATAGGATTTATGG + Intergenic
980909828 4:138983867-138983889 CTGTCATTATGTAAGATTTATGG - Intergenic
981790370 4:148529585-148529607 TTGTCCCACTGTAAGGTCTATGG - Intergenic
982468129 4:155756485-155756507 TTTTGCCTATGTAAAGTTTAAGG + Intergenic
983115859 4:163815108-163815130 ATGTGCTTATGTAAGATTTAAGG - Intronic
984241106 4:177220049-177220071 TTGTCCCTTTGAAATATTTATGG - Intergenic
984939420 4:184918321-184918343 TTGTCACTCTGTAAGCTTTGGGG + Intergenic
985314201 4:188637340-188637362 TTGGTGCTATGTAAGATTTAAGG + Intergenic
987670985 5:21008265-21008287 TTTTCACTATATAGGATTTATGG - Intergenic
987818369 5:22932074-22932096 TTGTCACTTTGTAAGCTTTGGGG - Intergenic
988682475 5:33497475-33497497 TTGTCACTATGAGGGATTTATGG - Intergenic
991981471 5:72235898-72235920 TTGTCACTGTATAGGATTTATGG + Intronic
992049891 5:72932314-72932336 TTGTCACTCTGTAAGCTTTGGGG - Intergenic
994061703 5:95486053-95486075 TACTCCCTATGTTAGTTTTAGGG - Intronic
994828326 5:104745197-104745219 TTGACCCTATGTAAGATTGGAGG + Intergenic
994830061 5:104770243-104770265 TTGTCCATATGAAAGTTTAATGG - Intergenic
995588326 5:113672220-113672242 TTATCACTATGTAGGATTTATGG + Intergenic
997052656 5:130400745-130400767 CAGTCCTTTTGTAAGATTTATGG - Intergenic
997072819 5:130638983-130639005 TTGTCACTCTGTAAGCTTTGGGG - Intergenic
998111977 5:139509338-139509360 TTGTCACTTTGTAAGCTTTGGGG - Intergenic
998211578 5:140203305-140203327 TTGTGGCTATGTAAGGTTTGGGG - Intronic
1000475030 5:161696503-161696525 TTGTGCCATTGTATGATTTATGG + Intronic
1001885137 5:175283227-175283249 TTTTCCATATGAAACATTTAGGG - Intergenic
1003459402 6:6316606-6316628 TTGTTCAGATGTCAGATTTATGG + Intronic
1003781030 6:9427067-9427089 TTGTACCAATGTAATATTTTTGG - Intergenic
1004919988 6:20367279-20367301 TTATCCCTTTGTATGATTCAAGG + Intergenic
1005188429 6:23189965-23189987 TTGGCCCTTGCTAAGATTTAAGG + Intergenic
1005271551 6:24169938-24169960 TTGTACCCATTAAAGATTTAAGG + Intergenic
1007030558 6:38622413-38622435 TTGTCACTTTGTAAGCTTTGGGG - Intronic
1009313882 6:62193230-62193252 TTGTTCCTCTGTTAAATTTAAGG + Intronic
1010787110 6:80016850-80016872 TTGCCAATATTTAAGATTTATGG - Intronic
1011224606 6:85093060-85093082 TTGTCACTTTGTAAGCTTTGGGG - Intergenic
1012006227 6:93716381-93716403 TTGTCCCCAAGCAATATTTATGG + Intergenic
1012672826 6:102077054-102077076 TTGTCCCTATGTAAGCACAAAGG - Intergenic
1012723136 6:102773626-102773648 TTCTCCCTATGTACATTTTAAGG - Intergenic
1013707218 6:112851255-112851277 TTGTCCATTATTAAGATTTATGG + Intergenic
1013907333 6:115235141-115235163 TTGTCACTCTGTAAGCCTTAGGG + Intergenic
1014646350 6:123977883-123977905 TTGTCCATCTGTAAAATTTGAGG - Intronic
1014767064 6:125418907-125418929 TTATCACTATACAAGATTTATGG - Intergenic
1017101469 6:150853055-150853077 TTGTCACTCTGTAAGCTTTGGGG - Intergenic
1020717701 7:11697082-11697104 TTTCCCTAATGTAAGATTTATGG + Intronic
1021193464 7:17648592-17648614 TTGACCCTATGTCAGTTTTGTGG - Intergenic
1022419026 7:30202984-30203006 TTGACACTATGTACTATTTATGG + Intergenic
1024870285 7:53956693-53956715 TTGTCACTCTGTAAGTTTTGGGG + Intergenic
1028494729 7:91450338-91450360 TTGTCACTCTGTAAGCTTTGGGG + Intergenic
1032671920 7:134091650-134091672 TTGTCAGTATATAAGATTTATGG - Intergenic
1033823321 7:145160055-145160077 GAGTCACTGTGTAAGATTTATGG - Intergenic
1035991949 8:4501311-4501333 TTGTCTTAATGTAAGATTAACGG + Intronic
1036166636 8:6440794-6440816 TTGTCCATATGTATCAGTTAAGG + Intronic
1036449237 8:8851043-8851065 GTGACCCTATGTAAGACTTTTGG - Intronic
1036914039 8:12787179-12787201 TTGTCAAGATGTAAGACTTAAGG - Intergenic
1038060795 8:23909347-23909369 TTGTCCTTAAGGAAGACTTAAGG - Intergenic
1038430289 8:27494415-27494437 TTGTCACTTTGTAAGCTTTGGGG + Intronic
1039344060 8:36684517-36684539 TTGTTCCAATGTAAGATCTCAGG + Intergenic
1039999185 8:42562138-42562160 TTGTCACTCTGTAAGCTTTGGGG + Intergenic
1040565145 8:48558254-48558276 TTCTCTCTATGTAACATTTTTGG - Intergenic
1042920110 8:73912004-73912026 TTGTCACTTTGTAAGCTTTGGGG - Intergenic
1044004962 8:86928507-86928529 TTGTCACTTTGTAAGCTTTGGGG + Intronic
1045928846 8:107600748-107600770 TTGTCACTTTGTAAGCTTTGGGG + Intergenic
1046440930 8:114253481-114253503 AAGTCCCTATGTCAGTTTTATGG - Intergenic
1047205090 8:122796783-122796805 TTGTCACTATATAGGATTTATGG - Intronic
1047669137 8:127125479-127125501 GTCTCCCAAGGTAAGATTTAAGG + Intergenic
1047807587 8:128376121-128376143 TTGTCACTTTGTAAGCTTTGGGG - Intergenic
1048161595 8:132026616-132026638 CTGACCCTCTGTGAGATTTAAGG - Intronic
1050184264 9:2956134-2956156 TTTTAACCATGTAAGATTTAAGG - Intergenic
1051001868 9:12292035-12292057 TTGTCACTATGTAGGATTTATGG - Intergenic
1051747643 9:20309975-20309997 TTTACACTATGTAAGATTAACGG + Intergenic
1052057282 9:23919856-23919878 TTGTCACTCTGTAAGCTTTGAGG + Intergenic
1052300105 9:26944376-26944398 TTGTCAATATGTCAGATTTGAGG + Intronic
1052891505 9:33704505-33704527 GAGTCCCTTTCTAAGATTTAGGG + Intergenic
1052950498 9:34206060-34206082 TTGTCACTTTGTAATTTTTAGGG + Intronic
1056392279 9:86151282-86151304 TTGTCACTCTGTAAGCTTTGGGG + Intergenic
1058391049 9:104496209-104496231 TGGTCCCTTGGTAAGCTTTATGG - Intergenic
1058693224 9:107536638-107536660 TTGACCCTTTGTAAAATTTATGG - Intergenic
1186637042 X:11417538-11417560 TTGTCCCAATGTCAGCTTCATGG + Intronic
1188090805 X:25963498-25963520 GTTTCCTTCTGTAAGATTTATGG - Intergenic
1188389632 X:29603673-29603695 TTGTGCATATGTGAGAATTATGG + Intronic
1189307675 X:39999177-39999199 GTGTGCTCATGTAAGATTTAAGG + Intergenic
1189720317 X:43909205-43909227 TTTGCCCTAAGCAAGATTTATGG - Intergenic
1190434438 X:50409339-50409361 TGATCTCTCTGTAAGATTTAGGG - Intronic
1192225470 X:69224311-69224333 TTCTCCCTTTGTAAAATGTAGGG - Intergenic
1193214391 X:78845592-78845614 TTGTTCCTATATAAATTTTAGGG - Intergenic
1194060502 X:89190890-89190912 TTCTCACTATGTAGGATTTATGG + Intergenic
1197513892 X:127401031-127401053 TTGTCACTCTGTAAGCTTTGGGG - Intergenic
1201430165 Y:13894939-13894961 TTGTCACTCTGTAAGCTTTGGGG - Intergenic
1201631704 Y:16077239-16077261 TTGTTGCTATGTAAGCTTTGGGG - Intergenic