ID: 944911462

View in Genome Browser
Species Human (GRCh38)
Location 2:204314441-204314463
Sequence TGGTAGTTAACTATATTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944911462_944911468 -9 Left 944911462 2:204314441-204314463 CCCCCCAATATAGTTAACTACCA No data
Right 944911468 2:204314455-204314477 TAACTACCATAGCAGGTTGTTGG No data
944911462_944911469 -5 Left 944911462 2:204314441-204314463 CCCCCCAATATAGTTAACTACCA No data
Right 944911469 2:204314459-204314481 TACCATAGCAGGTTGTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944911462 Original CRISPR TGGTAGTTAACTATATTGGG GGG (reversed) Intergenic
No off target data available for this crispr