ID: 944911620

View in Genome Browser
Species Human (GRCh38)
Location 2:204315892-204315914
Sequence CACACCTGCTGCCTTGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944911616_944911620 -2 Left 944911616 2:204315871-204315893 CCAGCCCTGGCATCACAGGATCA No data
Right 944911620 2:204315892-204315914 CACACCTGCTGCCTTGATGGTGG No data
944911617_944911620 -6 Left 944911617 2:204315875-204315897 CCCTGGCATCACAGGATCACACC No data
Right 944911620 2:204315892-204315914 CACACCTGCTGCCTTGATGGTGG No data
944911618_944911620 -7 Left 944911618 2:204315876-204315898 CCTGGCATCACAGGATCACACCT No data
Right 944911620 2:204315892-204315914 CACACCTGCTGCCTTGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944911620 Original CRISPR CACACCTGCTGCCTTGATGG TGG Intergenic
No off target data available for this crispr