ID: 944914971

View in Genome Browser
Species Human (GRCh38)
Location 2:204350341-204350363
Sequence CCTTATATGAAGAGGAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944914971_944914976 -1 Left 944914971 2:204350341-204350363 CCTGCCTTCCTCTTCATATAAGG No data
Right 944914976 2:204350363-204350385 GGAAAAACTTTTTTATCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944914971 Original CRISPR CCTTATATGAAGAGGAAGGC AGG (reversed) Intergenic
No off target data available for this crispr