ID: 944920212

View in Genome Browser
Species Human (GRCh38)
Location 2:204404801-204404823
Sequence CCTCCAATGCACAAGGCAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944920212_944920216 -4 Left 944920212 2:204404801-204404823 CCGTCTGCCTTGTGCATTGGAGG No data
Right 944920216 2:204404820-204404842 GAGGACATAAAACTCTCAGGTGG No data
944920212_944920217 -3 Left 944920212 2:204404801-204404823 CCGTCTGCCTTGTGCATTGGAGG No data
Right 944920217 2:204404821-204404843 AGGACATAAAACTCTCAGGTGGG No data
944920212_944920219 7 Left 944920212 2:204404801-204404823 CCGTCTGCCTTGTGCATTGGAGG No data
Right 944920219 2:204404831-204404853 ACTCTCAGGTGGGGAGTTGCAGG No data
944920212_944920215 -7 Left 944920212 2:204404801-204404823 CCGTCTGCCTTGTGCATTGGAGG No data
Right 944920215 2:204404817-204404839 TTGGAGGACATAAAACTCTCAGG No data
944920212_944920218 -2 Left 944920212 2:204404801-204404823 CCGTCTGCCTTGTGCATTGGAGG No data
Right 944920218 2:204404822-204404844 GGACATAAAACTCTCAGGTGGGG No data
944920212_944920221 30 Left 944920212 2:204404801-204404823 CCGTCTGCCTTGTGCATTGGAGG No data
Right 944920221 2:204404854-204404876 TGCTTTCCTTCTTTCTATTTGGG No data
944920212_944920220 29 Left 944920212 2:204404801-204404823 CCGTCTGCCTTGTGCATTGGAGG No data
Right 944920220 2:204404853-204404875 GTGCTTTCCTTCTTTCTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944920212 Original CRISPR CCTCCAATGCACAAGGCAGA CGG (reversed) Intergenic
No off target data available for this crispr