ID: 944920451

View in Genome Browser
Species Human (GRCh38)
Location 2:204407521-204407543
Sequence GTTCTTTGAAGCGGCTTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944920451_944920455 -5 Left 944920451 2:204407521-204407543 CCCAGGAAGCCGCTTCAAAGAAC No data
Right 944920455 2:204407539-204407561 AGAACCCATTATGATGGCTAAGG No data
944920451_944920459 24 Left 944920451 2:204407521-204407543 CCCAGGAAGCCGCTTCAAAGAAC No data
Right 944920459 2:204407568-204407590 CCATAATTACATTTCTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944920451 Original CRISPR GTTCTTTGAAGCGGCTTCCT GGG (reversed) Intergenic