ID: 944920455

View in Genome Browser
Species Human (GRCh38)
Location 2:204407539-204407561
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944920452_944920455 -6 Left 944920452 2:204407522-204407544 CCAGGAAGCCGCTTCAAAGAACC No data
Right 944920455 2:204407539-204407561 AGAACCCATTATGATGGCTAAGG No data
944920451_944920455 -5 Left 944920451 2:204407521-204407543 CCCAGGAAGCCGCTTCAAAGAAC No data
Right 944920455 2:204407539-204407561 AGAACCCATTATGATGGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type