ID: 944920459

View in Genome Browser
Species Human (GRCh38)
Location 2:204407568-204407590
Sequence CCATAATTACATTTCTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944920453_944920459 15 Left 944920453 2:204407530-204407552 CCGCTTCAAAGAACCCATTATGA No data
Right 944920459 2:204407568-204407590 CCATAATTACATTTCTCTCCAGG No data
944920452_944920459 23 Left 944920452 2:204407522-204407544 CCAGGAAGCCGCTTCAAAGAACC No data
Right 944920459 2:204407568-204407590 CCATAATTACATTTCTCTCCAGG No data
944920457_944920459 1 Left 944920457 2:204407544-204407566 CCATTATGATGGCTAAGGACTAA No data
Right 944920459 2:204407568-204407590 CCATAATTACATTTCTCTCCAGG No data
944920456_944920459 2 Left 944920456 2:204407543-204407565 CCCATTATGATGGCTAAGGACTA No data
Right 944920459 2:204407568-204407590 CCATAATTACATTTCTCTCCAGG No data
944920451_944920459 24 Left 944920451 2:204407521-204407543 CCCAGGAAGCCGCTTCAAAGAAC No data
Right 944920459 2:204407568-204407590 CCATAATTACATTTCTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944920459 Original CRISPR CCATAATTACATTTCTCTCC AGG Intergenic