ID: 944923967

View in Genome Browser
Species Human (GRCh38)
Location 2:204443978-204444000
Sequence ATGCAAATGGGGCAAGGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944923967_944923972 -1 Left 944923967 2:204443978-204444000 CCTGGTCCTTGCCCCATTTGCAT No data
Right 944923972 2:204444000-204444022 TGTAGCATTCATGATATGTCAGG No data
944923967_944923973 6 Left 944923967 2:204443978-204444000 CCTGGTCCTTGCCCCATTTGCAT No data
Right 944923973 2:204444007-204444029 TTCATGATATGTCAGGAGCAAGG No data
944923967_944923974 14 Left 944923967 2:204443978-204444000 CCTGGTCCTTGCCCCATTTGCAT No data
Right 944923974 2:204444015-204444037 ATGTCAGGAGCAAGGAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944923967 Original CRISPR ATGCAAATGGGGCAAGGACC AGG (reversed) Intergenic
No off target data available for this crispr