ID: 944923968

View in Genome Browser
Species Human (GRCh38)
Location 2:204443984-204444006
Sequence TGCTACATGCAAATGGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944923968_944923973 0 Left 944923968 2:204443984-204444006 CCTTGCCCCATTTGCATGTAGCA No data
Right 944923973 2:204444007-204444029 TTCATGATATGTCAGGAGCAAGG No data
944923968_944923974 8 Left 944923968 2:204443984-204444006 CCTTGCCCCATTTGCATGTAGCA No data
Right 944923974 2:204444015-204444037 ATGTCAGGAGCAAGGAATTCTGG No data
944923968_944923975 26 Left 944923968 2:204443984-204444006 CCTTGCCCCATTTGCATGTAGCA No data
Right 944923975 2:204444033-204444055 TCTGGTAGACTCATGATGCATGG No data
944923968_944923972 -7 Left 944923968 2:204443984-204444006 CCTTGCCCCATTTGCATGTAGCA No data
Right 944923972 2:204444000-204444022 TGTAGCATTCATGATATGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944923968 Original CRISPR TGCTACATGCAAATGGGGCA AGG (reversed) Intergenic
No off target data available for this crispr