ID: 944923972

View in Genome Browser
Species Human (GRCh38)
Location 2:204444000-204444022
Sequence TGTAGCATTCATGATATGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944923967_944923972 -1 Left 944923967 2:204443978-204444000 CCTGGTCCTTGCCCCATTTGCAT No data
Right 944923972 2:204444000-204444022 TGTAGCATTCATGATATGTCAGG No data
944923968_944923972 -7 Left 944923968 2:204443984-204444006 CCTTGCCCCATTTGCATGTAGCA No data
Right 944923972 2:204444000-204444022 TGTAGCATTCATGATATGTCAGG No data
944923966_944923972 0 Left 944923966 2:204443977-204443999 CCCTGGTCCTTGCCCCATTTGCA No data
Right 944923972 2:204444000-204444022 TGTAGCATTCATGATATGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944923972 Original CRISPR TGTAGCATTCATGATATGTC AGG Intergenic
No off target data available for this crispr