ID: 944923973

View in Genome Browser
Species Human (GRCh38)
Location 2:204444007-204444029
Sequence TTCATGATATGTCAGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944923968_944923973 0 Left 944923968 2:204443984-204444006 CCTTGCCCCATTTGCATGTAGCA No data
Right 944923973 2:204444007-204444029 TTCATGATATGTCAGGAGCAAGG No data
944923967_944923973 6 Left 944923967 2:204443978-204444000 CCTGGTCCTTGCCCCATTTGCAT No data
Right 944923973 2:204444007-204444029 TTCATGATATGTCAGGAGCAAGG No data
944923970_944923973 -6 Left 944923970 2:204443990-204444012 CCCATTTGCATGTAGCATTCATG No data
Right 944923973 2:204444007-204444029 TTCATGATATGTCAGGAGCAAGG No data
944923969_944923973 -5 Left 944923969 2:204443989-204444011 CCCCATTTGCATGTAGCATTCAT No data
Right 944923973 2:204444007-204444029 TTCATGATATGTCAGGAGCAAGG No data
944923966_944923973 7 Left 944923966 2:204443977-204443999 CCCTGGTCCTTGCCCCATTTGCA No data
Right 944923973 2:204444007-204444029 TTCATGATATGTCAGGAGCAAGG No data
944923971_944923973 -7 Left 944923971 2:204443991-204444013 CCATTTGCATGTAGCATTCATGA No data
Right 944923973 2:204444007-204444029 TTCATGATATGTCAGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944923973 Original CRISPR TTCATGATATGTCAGGAGCA AGG Intergenic
No off target data available for this crispr