ID: 944925506

View in Genome Browser
Species Human (GRCh38)
Location 2:204459954-204459976
Sequence AAATATATTCTACACTTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944925506_944925511 -1 Left 944925506 2:204459954-204459976 CCCCCCAAGTGTAGAATATATTT No data
Right 944925511 2:204459976-204459998 TACAGAGTTTACACACTAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944925506 Original CRISPR AAATATATTCTACACTTGGG GGG (reversed) Intergenic
No off target data available for this crispr