ID: 944926526

View in Genome Browser
Species Human (GRCh38)
Location 2:204470954-204470976
Sequence CAAGAGATAAATGTTTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944926523_944926526 13 Left 944926523 2:204470918-204470940 CCTGCGTCTGAAGCAAGCATGGC No data
Right 944926526 2:204470954-204470976 CAAGAGATAAATGTTTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944926526 Original CRISPR CAAGAGATAAATGTTTCCCT GGG Intergenic