ID: 944928236

View in Genome Browser
Species Human (GRCh38)
Location 2:204487655-204487677
Sequence GAGGCATTTTTTTCCTAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944928235_944928236 -5 Left 944928235 2:204487637-204487659 CCTTGGGTTATTCTCTTTGAGGC No data
Right 944928236 2:204487655-204487677 GAGGCATTTTTTTCCTAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944928236 Original CRISPR GAGGCATTTTTTTCCTAAAC TGG Intergenic
No off target data available for this crispr