ID: 944928291

View in Genome Browser
Species Human (GRCh38)
Location 2:204488517-204488539
Sequence TTTGATAATTTGGAGTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944928286_944928291 26 Left 944928286 2:204488468-204488490 CCAAGTGTGCCTTTTTATTGCTA No data
Right 944928291 2:204488517-204488539 TTTGATAATTTGGAGTTTGTTGG No data
944928287_944928291 17 Left 944928287 2:204488477-204488499 CCTTTTTATTGCTAGAGAAAGTG No data
Right 944928291 2:204488517-204488539 TTTGATAATTTGGAGTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944928291 Original CRISPR TTTGATAATTTGGAGTTTGT TGG Intergenic
No off target data available for this crispr