ID: 944928935

View in Genome Browser
Species Human (GRCh38)
Location 2:204496192-204496214
Sequence GAGATAAAAGAGATGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944928935_944928938 0 Left 944928935 2:204496192-204496214 CCCTGCTCCATCTCTTTTATCTC No data
Right 944928938 2:204496215-204496237 TTATGTGTCGAATACCAGAATGG No data
944928935_944928940 20 Left 944928935 2:204496192-204496214 CCCTGCTCCATCTCTTTTATCTC No data
Right 944928940 2:204496235-204496257 TGGATAAAAACATTAATTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944928935 Original CRISPR GAGATAAAAGAGATGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr