ID: 944937033

View in Genome Browser
Species Human (GRCh38)
Location 2:204580099-204580121
Sequence ACCCATAGTCTAGACTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 69}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944937028_944937033 -3 Left 944937028 2:204580079-204580101 CCAGTCCTTGACCCAGGGGGACC 0: 1
1: 0
2: 1
3: 12
4: 164
Right 944937033 2:204580099-204580121 ACCCATAGTCTAGACTCTGGAGG 0: 1
1: 0
2: 0
3: 4
4: 69
944937029_944937033 -8 Left 944937029 2:204580084-204580106 CCTTGACCCAGGGGGACCCATAG 0: 1
1: 0
2: 17
3: 13
4: 106
Right 944937033 2:204580099-204580121 ACCCATAGTCTAGACTCTGGAGG 0: 1
1: 0
2: 0
3: 4
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944937033 Original CRISPR ACCCATAGTCTAGACTCTGG AGG Intronic
904064674 1:27740022-27740044 ACCCAGAGTCTAGAATACGGAGG - Intronic
909024448 1:70466797-70466819 ACCCAGAATCTAGTTTCTGGTGG + Intergenic
915246958 1:154562695-154562717 AGCCATAGTCTAGACCCTATAGG - Intergenic
1068167186 10:53345387-53345409 AATCATAGTCGAGACGCTGGGGG + Intergenic
1073399639 10:103246065-103246087 CCCCAGAGTCTAGCATCTGGAGG - Exonic
1077282358 11:1751420-1751442 ACCCACAGTCTAGACAGGGGGGG + Intronic
1079522403 11:21343561-21343583 ACCCATGGCCTAGACTGTTGTGG - Intronic
1080172060 11:29316286-29316308 ACACATAGTTTAGGCTTTGGAGG - Intergenic
1085342434 11:75741887-75741909 ACCCTTAGTCTAGACTAATGGGG - Intergenic
1087008135 11:93488829-93488851 ATCCAAAGTCTAGACCTTGGGGG + Intronic
1088225732 11:107617724-107617746 TCCAATAGTCTAGTATCTGGCGG - Intronic
1089407324 11:118209007-118209029 CTCCATATTCTAGATTCTGGGGG + Intronic
1099759096 12:86894599-86894621 ATCCATAGTCTAGACTGAGCAGG + Intergenic
1102714663 12:114959934-114959956 CCTGATAGTCTAGATTCTGGGGG - Intergenic
1104198590 12:126565891-126565913 TCCCATAGTCTGGACTCATGGGG - Intergenic
1108165276 13:47686663-47686685 ACCAATAATCAAGTCTCTGGAGG - Intergenic
1109738032 13:66512547-66512569 ACACAGAATCTAGAATCTGGGGG - Intronic
1117443147 14:55778702-55778724 ACACAGTGTGTAGACTCTGGGGG + Intergenic
1122970267 14:105149639-105149661 ACCCACAGTCTTGGCTCTGAGGG - Intronic
1131628730 15:94152738-94152760 CCCTATAGTCTAGACTCCGCTGG + Intergenic
1133610574 16:7429572-7429594 ACCCAGAGCCTAGAATCTAGAGG + Intronic
1137549391 16:49426916-49426938 ACCCAAAGTCCATAGTCTGGTGG + Intergenic
1143333240 17:6153433-6153455 ACCAATTGTCAAGACTCAGGAGG - Intergenic
1150105841 17:62461934-62461956 GCCCATAGTCTAGAGGCAGGAGG - Intronic
1151118863 17:71769901-71769923 ACCCAAAGTCAAGTCTATGGAGG - Intergenic
1161841983 19:6687716-6687738 TCCCATAATCTATACTCTTGGGG - Intronic
925911435 2:8575898-8575920 ACCCAGAGTCCAGACTCCGCGGG + Intergenic
925999728 2:9320907-9320929 ACCAATAGACAAGACTCTGTTGG + Intronic
926793748 2:16601451-16601473 ACCCATATTCTAGACTATTTGGG - Intronic
928684043 2:33729428-33729450 ACCCAAAGCCTAGTCTCTAGGGG + Intergenic
931743017 2:65265765-65265787 TCACATAGTCCAGAGTCTGGTGG - Intronic
933057906 2:77696576-77696598 ACCCATTGTCTAGACCCCGTGGG + Intergenic
933271996 2:80242878-80242900 ACCCATAGCCTGGACCCTGGTGG - Intronic
935187876 2:100750790-100750812 TCCCGTTGTCTATACTCTGGAGG + Intergenic
935520446 2:104097711-104097733 AGCCATACTCTAGGCTCTGGAGG - Intergenic
939390136 2:141557735-141557757 ACTCTTAGTCTAGAGTCTAGAGG - Intronic
942021698 2:171872599-171872621 ACCCATATTCTAGTTACTGGTGG - Intronic
942412557 2:175726113-175726135 ACCCATGGTCTAGATCCTAGAGG + Intergenic
944937033 2:204580099-204580121 ACCCATAGTCTAGACTCTGGAGG + Intronic
945522069 2:210840719-210840741 ATTCAGAATCTAGACTCTGGAGG - Intergenic
948561746 2:238858500-238858522 ACCCATTGTCTTGTGTCTGGGGG + Intronic
1171069480 20:22053756-22053778 ACCCATATCCTAGATTCTTGGGG - Intergenic
1172273840 20:33669286-33669308 ACCCTGAGTCAAGACTGTGGAGG + Intronic
1179445644 21:41428397-41428419 ACCCACAGTGGAGGCTCTGGAGG + Intronic
1179675719 21:42980527-42980549 ATGCAAAGTATAGACTCTGGTGG + Intronic
1181122056 22:20676829-20676851 ACCAATAGTTCAGACTCTGTAGG - Intergenic
951720430 3:25691932-25691954 ACCCAGAGTCTAGACTGAGAAGG + Intergenic
954322463 3:49841424-49841446 ACTCATATTCTTCACTCTGGTGG - Intronic
962173388 3:133126515-133126537 AATGCTAGTCTAGACTCTGGAGG - Intronic
965515004 3:169611889-169611911 AACCGTGTTCTAGACTCTGGAGG - Intronic
968965853 4:3768795-3768817 ACCCCAAGTTTAGATTCTGGGGG + Intergenic
969155762 4:5208384-5208406 AACCATGGTCTGGGCTCTGGAGG + Intronic
984334723 4:178376571-178376593 ACCCAAACTGTAGTCTCTGGGGG + Intergenic
996391406 5:122966568-122966590 ACCCCTAGACTAGAGGCTGGTGG + Intronic
998936940 5:147239467-147239489 ACCCTGAGTATAGACTGTGGCGG - Intronic
999773049 5:154789972-154789994 AGCTATAGTCCTGACTCTGGTGG + Intronic
1001860005 5:175046043-175046065 ACACAAAGTCTAGACTGTGTGGG - Intergenic
1002935574 6:1669338-1669360 ACTCTGAGTCTACACTCTGGAGG + Intronic
1003042133 6:2698212-2698234 ACCCACAGCCTGGACTCTGATGG + Intronic
1022818166 7:33933238-33933260 ACCCAAAATGTAGCCTCTGGAGG - Intronic
1028110564 7:86935527-86935549 ACCACTGGTCTAGACTCTAGAGG - Intronic
1028949049 7:96613100-96613122 ATGCATTGTCTAGACTCTAGAGG + Intronic
1032035004 7:128515136-128515158 GCCCATAGTCTAGAGGCAGGAGG - Intergenic
1032476952 7:132218043-132218065 ACCCACCGACTGGACTCTGGAGG - Intronic
1036073771 8:5472293-5472315 ACCCATAGTCCATGTTCTGGGGG - Intergenic
1038680244 8:29660151-29660173 ACCCTGAGTCCAGGCTCTGGTGG - Intergenic
1062651539 9:137580290-137580312 ATTCACAGTCTAGGCTCTGGAGG - Intergenic
1185760499 X:2687081-2687103 AGCCAGAGTCTAGACTCTACTGG + Intergenic
1185887161 X:3793091-3793113 ACCCATTGTTTAGACTTTGATGG + Intergenic
1190505659 X:51123753-51123775 ACCCTGATTCTAGACTCTGGAGG - Intergenic
1194304821 X:92230965-92230987 AGCCATAGAATAGAGTCTGGAGG + Intronic
1196404666 X:115348633-115348655 ATCCATTGTCTGGACTCTGATGG + Intergenic
1197605983 X:128585994-128586016 ACCCCTAGTCTAGTCTCTTGAGG + Intergenic
1197755869 X:129994242-129994264 ACCCATAGCCTACACTGCGGTGG - Intronic