ID: 944937427

View in Genome Browser
Species Human (GRCh38)
Location 2:204583940-204583962
Sequence GGCCTGCTTGCCCAAGTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944937423_944937427 4 Left 944937423 2:204583913-204583935 CCACTGCAGCTTGCTGCTGCCAG 0: 1
1: 0
2: 1
3: 66
4: 521
Right 944937427 2:204583940-204583962 GGCCTGCTTGCCCAAGTTCCTGG 0: 1
1: 0
2: 0
3: 9
4: 152
944937422_944937427 5 Left 944937422 2:204583912-204583934 CCCACTGCAGCTTGCTGCTGCCA 0: 1
1: 0
2: 3
3: 23
4: 294
Right 944937427 2:204583940-204583962 GGCCTGCTTGCCCAAGTTCCTGG 0: 1
1: 0
2: 0
3: 9
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944937427 Original CRISPR GGCCTGCTTGCCCAAGTTCC TGG Intronic
903283325 1:22262654-22262676 GGCTGCCTTGCCCAGGTTCCTGG + Intergenic
907388027 1:54138405-54138427 GGCTGGCCTGCCCAAGTTCACGG + Intronic
910003655 1:82367698-82367720 GGCATGCTTGCCCAAATTGCTGG + Intergenic
912305581 1:108562742-108562764 GACCTTCTTGGACAAGTTCCTGG - Intronic
914914054 1:151807418-151807440 GGCCTGCTGGCCCACCTCCCTGG - Exonic
919910741 1:202109229-202109251 GGGCATCTTGCCAAAGTTCCAGG + Intergenic
922987628 1:229878243-229878265 GGGCTGCTTGCCCAAGCTACAGG + Intergenic
1063115165 10:3067625-3067647 GGGCTCCTTGCGGAAGTTCCTGG + Exonic
1065200121 10:23304561-23304583 GTCCTGCTTGCCCAGGAGCCTGG + Intronic
1065259215 10:23907537-23907559 GGTCCGATAGCCCAAGTTCCTGG + Intronic
1066748434 10:38627195-38627217 GGGCTGCTTGCCCTGGATCCTGG - Intergenic
1066968243 10:42290580-42290602 GGGCTGCTTGCCCTGGATCCTGG + Intergenic
1067290026 10:44933688-44933710 GGGCTGCTTCCAGAAGTTCCTGG + Exonic
1069833327 10:71294100-71294122 GGCCTGCCTCACCAAGATCCAGG + Intronic
1070152580 10:73814023-73814045 GGCCTGCTTACCCCAGGTCTAGG - Exonic
1070570823 10:77638297-77638319 CGCCTGCTAGCCCATGTTCTCGG + Intronic
1070755897 10:78993066-78993088 GTGCTGCTTACCCAAGTTGCTGG - Intergenic
1073438832 10:103539906-103539928 AGCCAGCTTGCCCACATTCCAGG - Intronic
1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG + Exonic
1075076952 10:119358132-119358154 GGCCAGCTTGCCTGAGTTCCTGG + Intronic
1076662525 10:132065020-132065042 GGCCTGCACGCCCAGGTTCTGGG - Intergenic
1079081130 11:17414439-17414461 GGCCAGCCTGCCCCAGTTCCGGG - Intronic
1079237450 11:18700464-18700486 TGCCTGCTTTCCCACATTCCTGG + Intronic
1081498731 11:43644371-43644393 AGGCTGCTTGCCCACCTTCCAGG - Intronic
1081564419 11:44248734-44248756 GCCCAGCTTCCCCAATTTCCTGG + Intergenic
1083894623 11:65613841-65613863 GGCCCGGATGCCCAGGTTCCGGG - Exonic
1085258932 11:75193315-75193337 CACCTTCCTGCCCAAGTTCCTGG + Exonic
1085825962 11:79847192-79847214 GGGGTGCTTGCCCTGGTTCCTGG + Intergenic
1088078405 11:105879335-105879357 GGCCATCTTGCCCAGGTCCCCGG + Intronic
1089834513 11:121358188-121358210 ACCCTGTTTGTCCAAGTTCCTGG - Intergenic
1092330599 12:7583601-7583623 GGCCTACTTGCCCACTTGCCTGG + Intergenic
1094192744 12:27713484-27713506 GGGCTGCGTGTACAAGTTCCTGG + Intronic
1097193934 12:57233562-57233584 GGCCTGCACCCCCATGTTCCGGG + Exonic
1098932095 12:76430250-76430272 GGCTTGCTTGACCAAGAACCAGG + Intronic
1103699413 12:122841046-122841068 GGCCTGCTTGGCCAAGGGACAGG + Intronic
1103772388 12:123338300-123338322 CCCCTGCTTGCCCAAGTGCTGGG - Intronic
1104662604 12:130621855-130621877 GGCCTGCTGGCCTCAGTACCAGG - Intronic
1104798000 12:131533114-131533136 GGCATTCTTGCCTGAGTTCCGGG - Intergenic
1112007319 13:95265559-95265581 TTCCTACTTGCCCAAATTCCTGG - Intronic
1113451829 13:110415738-110415760 GGCCTGCTTGCTCAACTCACCGG + Intronic
1113731144 13:112642325-112642347 GAAGTGCTTGCCCAAGGTCCAGG - Intergenic
1114505490 14:23209054-23209076 GGCCTGGTTGCCCATGTTTATGG + Intronic
1116413322 14:44650376-44650398 GTCATCCTTCCCCAAGTTCCAGG + Intergenic
1116769872 14:49114805-49114827 AGCCTGCTTTGCAAAGTTCCCGG - Intergenic
1117367256 14:55041449-55041471 GGACCCCTTCCCCAAGTTCCTGG + Intronic
1117841036 14:59860733-59860755 GACCTGGTTGCCCAAGATCATGG + Intronic
1118907483 14:70033160-70033182 GGCCTGCGTGATCAAATTCCGGG - Intergenic
1119332119 14:73802652-73802674 TGCCTTCCTGCCCTAGTTCCCGG - Intergenic
1121401124 14:93678130-93678152 AGCCTGGTTGTCCAAGTGCCAGG - Intronic
1121605085 14:95234614-95234636 GGCCAGGATGCCCAAGTGCCGGG + Intronic
1128248743 15:66150535-66150557 GGCCTGCTTGCCCATGGACAGGG - Intronic
1128633611 15:69288765-69288787 GGCCTGGTTGCCCCACTGCCTGG - Intergenic
1133283684 16:4680862-4680884 GGCCTGCCTGACCGAGCTCCTGG - Intronic
1136927062 16:34384257-34384279 GGCCTGCTTCCCAAAGTCCTTGG + Intergenic
1136977512 16:35027550-35027572 GGCCTGCTTCCCAAAGTCCTTGG - Intergenic
1137416034 16:48280760-48280782 TCCCTGCTTGCCCAAGTCCTGGG + Intronic
1139205841 16:65027599-65027621 GTCCTTGTTGCCCAAGTTCATGG - Intronic
1139611849 16:68064750-68064772 GACCTGCTGGCCCAAATGCCAGG - Intronic
1139778137 16:69330012-69330034 GGCCTGCGTGCCCCGCTTCCAGG - Exonic
1140090410 16:71833853-71833875 GGCTTACTTGCACAACTTCCGGG + Intergenic
1143136613 17:4715977-4715999 GTCCCGCTTGCCCAAGTACACGG - Exonic
1144377261 17:14656983-14657005 GCCCTGCTTGCCCATGGTCCAGG - Intergenic
1144788147 17:17843174-17843196 GGCCTGCTTGCTCAAGGCCTGGG + Intergenic
1149268462 17:54952791-54952813 GCCATGCTGGCCCTAGTTCCTGG - Intronic
1149709071 17:58722171-58722193 CCCCTGCTTTCCCAACTTCCTGG - Intronic
1151316350 17:73324992-73325014 GCCCTGCTTCCCCACGTACCAGG + Intergenic
1151348810 17:73519443-73519465 GGCCTGTCTGCCCAATTTCAGGG + Intronic
1156753226 18:40486694-40486716 GGCCTACCTGCCCAAGTACAAGG + Intergenic
1161481456 19:4512808-4512830 GGCCTCTTTGGCCAAGTTCACGG + Exonic
1162957366 19:14106933-14106955 GGCCTGCTTGGCTAAGGTCTGGG + Intronic
1165850538 19:38847973-38847995 GGCCTGGCTGCCCCAGTTTCTGG - Intronic
1166769159 19:45270447-45270469 GGCCTGATTGCTCAAGACCCAGG - Intronic
1167236751 19:48320232-48320254 CCCCAGCTTTCCCAAGTTCCAGG - Intronic
1168076408 19:53982779-53982801 GGCCTCCTTGGCCAGGGTCCCGG - Exonic
1168405091 19:56106568-56106590 GGCCGTCTGGCCCCAGTTCCTGG + Intronic
929543600 2:42841403-42841425 GTCCTGCATGCCCAGCTTCCAGG - Intergenic
929604405 2:43225566-43225588 CAGCTGCTCGCCCAAGTTCCCGG - Exonic
934311409 2:91869337-91869359 GGGCTGCTTGCCCTGGATCCTGG - Intergenic
935221785 2:101021442-101021464 GGCCTGTTAAACCAAGTTCCTGG - Intronic
935678828 2:105618842-105618864 GGCCTGTTTGCCAAAGGTCTGGG + Intergenic
938299646 2:130201011-130201033 GGCCTGCTTGGCCACCCTCCAGG - Intergenic
938457062 2:131473475-131473497 GGCCTGCTTGGCCACCCTCCAGG + Intronic
944937427 2:204583940-204583962 GGCCTGCTTGCCCAAGTTCCTGG + Intronic
946439279 2:219681385-219681407 GCCCTGCTTGCTCAAGGCCCTGG - Intergenic
947389450 2:229623929-229623951 GGCCTGATTGTCCCAGTTCATGG - Intronic
1169043900 20:2520700-2520722 GGGGTGCCTGCCCAAGTTTCTGG - Intronic
1169491119 20:6072144-6072166 GGCCTCCCCGCCCAACTTCCAGG + Intergenic
1170575434 20:17659032-17659054 GGCCTTCTTGCCCTGGTTCTGGG + Intronic
1170575459 20:17659122-17659144 GGCCTTCTTGCCCTGGTTCTGGG + Intronic
1170575470 20:17659152-17659174 GGCCTTCTTGCCCTGGTTCTGGG + Intronic
1170575481 20:17659182-17659204 GGCCTTCTTGCCCTGGTTCTGGG + Intronic
1170575492 20:17659212-17659234 GGCCTTCTTGCCCTGGTTCTGGG + Intronic
1170575586 20:17659512-17659534 GGCCTTCTTGCCCTGGTTCTGGG + Intronic
1174172298 20:48625274-48625296 GGGCTGGTGGCCCCAGTTCCAGG + Exonic
1174289203 20:49495723-49495745 GGTTTCCTGGCCCAAGTTCCTGG + Intergenic
1176358492 21:5973001-5973023 GGCGTGCTTGGCCAACTCCCCGG + Exonic
1178508852 21:33185328-33185350 GGCCTGCTTGCTCATGTGGCTGG - Intergenic
1179765026 21:43565549-43565571 GGCGTGCTTGGCCAACTCCCCGG - Intronic
1180538163 22:16415140-16415162 GGGCTGCTTGCCCTGGATCCTGG - Intergenic
1183587217 22:38759839-38759861 AGCCTGCTTGCCCCATGTCCAGG + Intronic
1185366989 22:50441325-50441347 GGGCTGCTCCCCCAAGTCCCTGG - Intronic
1185370887 22:50460378-50460400 GGCGTTCTTGACCAGGTTCCGGG + Exonic
949872908 3:8604446-8604468 GGCCTGCTGTACCAATTTCCTGG + Intergenic
950634291 3:14304065-14304087 GGCCTGCAAGCCCAGGTTGCTGG + Intergenic
954465971 3:50654973-50654995 GCACTCCTTGCCCAAGTTCAGGG - Intergenic
955341781 3:58130634-58130656 GGCCTGCATGGCCGAGGTCCCGG + Intronic
961820850 3:129574980-129575002 GCCCTGCATACCCAAGGTCCTGG - Intronic
962026487 3:131553437-131553459 GCCTTGCTTGCCCAAGTGACAGG + Intronic
964021859 3:152022296-152022318 TGCCTGTTTTCTCAAGTTCCTGG - Intergenic
965372117 3:167875984-167876006 TGCCAGCTAGCCCAAGTTTCTGG + Intergenic
965774875 3:172218230-172218252 GTCCTGCTTCCCCAATTTCTAGG - Intronic
967011333 3:185437514-185437536 GGTCTTCTTGGGCAAGTTCCGGG + Exonic
968645735 4:1739767-1739789 GGCCTCCTTACCCCAGTTCCAGG - Exonic
968726722 4:2251306-2251328 GGCCTGGGTGCCCCAGTGCCTGG - Intronic
968922582 4:3530368-3530390 GGCCTGCCTGCCATAGTACCAGG + Intronic
974785005 4:66609006-66609028 GGCCTGCTAGCCCTACTTACTGG - Intergenic
976123083 4:81804300-81804322 GGCCTGAAGGCCCAAGTTCTTGG + Intronic
976710687 4:88067816-88067838 TTCCTGCTTGCCCAAGTCCTTGG + Intronic
977423049 4:96828030-96828052 GTCCTGCCTTCCCAGGTTCCAGG - Intergenic
981328928 4:143485110-143485132 GGCCTGATTCCACAAGTTCTAGG - Intergenic
981515897 4:145609295-145609317 GGCCTCATTCCCCAAGTTTCAGG + Intergenic
986996117 5:13609519-13609541 GTCCGGCCTGCCTAAGTTCCCGG + Intergenic
987662504 5:20894887-20894909 GGCCAGCCTGCCCAAGGTCGTGG + Intergenic
999093609 5:148958683-148958705 GGCCTCCTTGTCCATGTGCCAGG + Intronic
1004049220 6:12058688-12058710 GGGCTGCTTGCCCAAGCTGCTGG - Intronic
1005571089 6:27146466-27146488 GGCGTGCTTGGCCAACTCCCCGG + Exonic
1005643079 6:27815354-27815376 GGCGTGCTTGGCCAATTCCCCGG - Exonic
1006045391 6:31291441-31291463 GGACTCATTGCCCAAGTTTCAGG + Intronic
1006677592 6:35775645-35775667 GGCCTGCCTCCCCCGGTTCCAGG + Intergenic
1007372787 6:41437715-41437737 TGCCTGATTGCTTAAGTTCCAGG - Intergenic
1007700263 6:43762245-43762267 TGCCAGCTTCTCCAAGTTCCAGG - Intergenic
1011954967 6:93015532-93015554 AGCCTGCTTCCCCAAGATCATGG + Intergenic
1018692976 6:166363929-166363951 TGCCTGCTTCCCAAAGTGCCGGG - Intergenic
1019118049 6:169781597-169781619 GGTCTGCTTGGCCAGGGTCCAGG + Intergenic
1019908260 7:4081264-4081286 GGCCACGTTGCCCAAGTTCTGGG - Intronic
1021052297 7:16002666-16002688 GGCCTGCTGGCCAACATTCCAGG - Intergenic
1022817910 7:33931060-33931082 GGTCTGCTTACCCAAGTCCTGGG + Intronic
1023523887 7:41078398-41078420 GTACTGGTTGGCCAAGTTCCTGG + Intergenic
1025605811 7:63039165-63039187 TGCCTGCTTGGACCAGTTCCTGG - Intergenic
1029226953 7:99035188-99035210 GGCCAGCTTAGCCAAGATCCCGG - Intronic
1031520651 7:122761295-122761317 GGCCTGGCTGCCCATGTTCCAGG - Intronic
1036728047 8:11237890-11237912 CACCTGCTTGACCAAGTACCTGG - Intergenic
1038436152 8:27538101-27538123 GGCCTGCCTTCCCAAGTGCTTGG - Intronic
1041157111 8:54999138-54999160 GTCATTTTTGCCCAAGTTCCAGG + Intergenic
1042911933 8:73836825-73836847 GGCCTGCTTTCCCAAGTGGTAGG + Intronic
1048329716 8:133463506-133463528 GAGCTGCATGCCCAGGTTCCTGG - Intronic
1051487080 9:17620624-17620646 GGACTGCTTGACCAATTTGCTGG - Intronic
1057832634 9:98418778-98418800 GGCATCTTTGCCCAGGTTCCTGG + Intronic
1058836464 9:108862363-108862385 GGCCTGGTTGCCCACCTTCTTGG - Exonic
1061543225 9:131289504-131289526 GGCCTGCCTGCCCCAGCTGCCGG - Intergenic
1061764104 9:132870618-132870640 GGGCTGCCAGCCCAAGTGCCGGG + Intronic
1062348386 9:136126216-136126238 GGGCTGCTTGCCCATTTTCTTGG + Intergenic
1062460911 9:136662225-136662247 GGCCTGCTTGCCCATCTCCAGGG + Intronic
1186545184 X:10441830-10441852 GGCTTACTTGCCCAAATTCAAGG + Intergenic
1187126852 X:16462202-16462224 GGCCTGCTGGCCCATGTTGGGGG - Intergenic
1188707923 X:33358004-33358026 GGACTGCTTGCCCTAATTCTGGG - Intergenic
1189279753 X:39812892-39812914 GGCCAGCTTGCCCACCCTCCAGG + Intergenic
1189626666 X:42904533-42904555 GGAGTGCTTGACCAAGTACCTGG + Intergenic
1194088875 X:89562101-89562123 TGCCTGCATGCCTAACTTCCTGG - Intergenic
1196588470 X:117458413-117458435 GGCTGGCAGGCCCAAGTTCCAGG + Intergenic
1200108244 X:153726043-153726065 GGCCTTCTCGCCCAAGTTCGGGG + Exonic
1200441551 Y:3218153-3218175 TGCCTGCATGCCTAACTTCCTGG - Intergenic