ID: 944938018

View in Genome Browser
Species Human (GRCh38)
Location 2:204589981-204590003
Sequence TGGGAAATATCAAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 351}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944938018_944938028 2 Left 944938018 2:204589981-204590003 CCTTCCTCCCTTGATATTTCCCA 0: 1
1: 0
2: 2
3: 22
4: 351
Right 944938028 2:204590006-204590028 TATGAAATGGGAAGGATAATGGG 0: 1
1: 0
2: 2
3: 42
4: 388
944938018_944938024 -6 Left 944938018 2:204589981-204590003 CCTTCCTCCCTTGATATTTCCCA 0: 1
1: 0
2: 2
3: 22
4: 351
Right 944938024 2:204589998-204590020 TTCCCACATATGAAATGGGAAGG 0: 1
1: 0
2: 2
3: 55
4: 391
944938018_944938030 17 Left 944938018 2:204589981-204590003 CCTTCCTCCCTTGATATTTCCCA 0: 1
1: 0
2: 2
3: 22
4: 351
Right 944938030 2:204590021-204590043 ATAATGGGTTTCTGCTTAGAGGG 0: 1
1: 0
2: 1
3: 8
4: 133
944938018_944938029 16 Left 944938018 2:204589981-204590003 CCTTCCTCCCTTGATATTTCCCA 0: 1
1: 0
2: 2
3: 22
4: 351
Right 944938029 2:204590020-204590042 GATAATGGGTTTCTGCTTAGAGG 0: 1
1: 0
2: 0
3: 12
4: 120
944938018_944938023 -10 Left 944938018 2:204589981-204590003 CCTTCCTCCCTTGATATTTCCCA 0: 1
1: 0
2: 2
3: 22
4: 351
Right 944938023 2:204589994-204590016 ATATTTCCCACATATGAAATGGG 0: 1
1: 0
2: 3
3: 34
4: 434
944938018_944938027 1 Left 944938018 2:204589981-204590003 CCTTCCTCCCTTGATATTTCCCA 0: 1
1: 0
2: 2
3: 22
4: 351
Right 944938027 2:204590005-204590027 ATATGAAATGGGAAGGATAATGG 0: 1
1: 0
2: 4
3: 41
4: 495

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944938018 Original CRISPR TGGGAAATATCAAGGGAGGA AGG (reversed) Intronic
900868558 1:5285865-5285887 TTGGAATTTTCAAGGAAGGAGGG + Intergenic
901144030 1:7053226-7053248 TGGGAAAGAACCAGGAAGGAAGG - Intronic
902757519 1:18558644-18558666 TGGGATACATCCAGGAAGGAAGG - Intergenic
903723260 1:25421727-25421749 TGGTAAGTGTCAAGGAAGGAAGG + Intronic
904535530 1:31197058-31197080 TGGAAAAAATAAAGGAAGGAGGG - Intronic
904940421 1:34162229-34162251 TGGGAAGTCTCCAGGGAGGCTGG + Intronic
905138459 1:35820227-35820249 TGAGAAAGTTCAAGGGAGAAAGG + Intronic
906299417 1:44671185-44671207 TGGGAAAAAGAGAGGGAGGAGGG + Intronic
906920801 1:50062491-50062513 TGGGAAATATCAATTAAGGTGGG - Intronic
907361810 1:53922929-53922951 TGGAAAATAGCAAGGGGGAATGG - Intronic
907594770 1:55709400-55709422 TGGGAAAGATAAAAGGAGGATGG - Intergenic
907811834 1:57878821-57878843 TGGGAAGGATGGAGGGAGGAGGG - Intronic
907881345 1:58551888-58551910 AGGGAAATCTCTAGGGAGGCAGG - Intergenic
908292225 1:62679451-62679473 AGGGAAAAAACAATGGAGGAGGG + Intronic
908872474 1:68629665-68629687 TGGAGACTATTAAGGGAGGAAGG - Intergenic
909099800 1:71336411-71336433 AGGGAAGAATCAAGGGAGAAGGG - Intergenic
909246781 1:73296411-73296433 TGAGAAATATGAAAGAAGGAAGG - Intergenic
909390943 1:75121177-75121199 TGGAAAATATCAGGAGAGAAAGG - Intergenic
910696828 1:90027547-90027569 AGGGAAATATACAGGGAGTAGGG + Exonic
910741062 1:90517036-90517058 TGAAAAATAACAAGGGAAGAAGG + Intergenic
911957508 1:104256338-104256360 AGGGAAGAATGAAGGGAGGAAGG - Intergenic
911972555 1:104455452-104455474 TGGAAAAAAGCAAGGTAGGATGG - Intergenic
912698404 1:111858237-111858259 AGGGAAATGGCAAGGGAGAAGGG - Intronic
913385986 1:118258990-118259012 AGCGAAATATCAAGGCAGGAGGG + Intergenic
915613573 1:157015906-157015928 TGGGAATTCTCAACTGAGGAGGG + Intronic
915719838 1:157976801-157976823 TGGGAAATATCAGGGCCTGAGGG - Intergenic
916735793 1:167605819-167605841 TGGGAAATACCAATAGAGGAAGG - Intergenic
918326220 1:183413228-183413250 TGGAAGATGTAAAGGGAGGAGGG + Intronic
919698505 1:200606593-200606615 TGGACAATATCAAGGGTAGAAGG + Intronic
919808171 1:201393072-201393094 TGGGGAAGACCAGGGGAGGAAGG + Intronic
920600626 1:207321130-207321152 GGGGAAATAACTAAGGAGGAAGG - Intergenic
920611749 1:207446843-207446865 AGGGGAGTATAAAGGGAGGATGG - Intergenic
921901438 1:220455722-220455744 AGGGAAGCATCAAGGGAGAAGGG - Intergenic
922074602 1:222230959-222230981 TGGGAAATATCTTGGAAGGCAGG - Intergenic
922367823 1:224882547-224882569 TGGAGAATTTCAAGGGAGGGAGG + Intergenic
922402763 1:225277077-225277099 GGGGAAATGGCAAGGGGGGAGGG + Intronic
922471404 1:225879545-225879567 GGGGAGAGATCAAGGCAGGAGGG - Intronic
923849125 1:237773917-237773939 TAGTAAATATTAAGGAAGGAAGG + Intronic
924554749 1:245108808-245108830 TGGCAACTGTCAAGGAAGGAGGG - Intronic
1062812563 10:477525-477547 TGGGAGATATGAGGGGAGGAAGG + Intronic
1063816841 10:9785120-9785142 TGGGGAAAATCAAGGAAGGGAGG + Intergenic
1064587271 10:16851803-16851825 AGGGAAATATAGAGGGAGGGAGG - Intronic
1065314102 10:24445274-24445296 ATGGAAATATCAAGGAAGGGAGG - Intronic
1067810101 10:49419361-49419383 TGGGAAATATCCAGGGATGACGG + Intergenic
1069629871 10:69890981-69891003 AGGGAAACAGAAAGGGAGGAAGG - Intronic
1070757283 10:79001208-79001230 TGGGAAATACCACAGGAGGGTGG - Intergenic
1071960255 10:90803306-90803328 AGGGAAAGATCAGGGGAGAAGGG - Intronic
1072283551 10:93892409-93892431 AGGGAAATTTCAGGGAAGGATGG - Intergenic
1073046460 10:100641940-100641962 TTGGAAAGATGAAAGGAGGAAGG + Intergenic
1073589400 10:104742228-104742250 TGGGAAACTTCAAGAGATGATGG - Intronic
1074147650 10:110730763-110730785 TGGGAAACACAAAGGAAGGAGGG - Intronic
1074657124 10:115603328-115603350 TGGGAAATACCAAGGGATTTAGG + Intronic
1075634721 10:124022740-124022762 GGGGAAACATCAAGGGGGAAGGG - Intronic
1076043401 10:127270550-127270572 TGGGAAAGAGGAAGGAAGGAAGG - Intronic
1076900283 10:133334618-133334640 GGGGAAGGATCAGGGGAGGAAGG + Intronic
1078133127 11:8629864-8629886 TGGAAAATTTCCACGGAGGAAGG + Intronic
1079234061 11:18674910-18674932 TGGGAAATATCTGGGGAAGAAGG - Intergenic
1079576016 11:22003757-22003779 AGGGAAAAATCAGGGGAGAAGGG + Intergenic
1080967856 11:37234507-37234529 AGGGAAAAATCAAGGGAAAAGGG - Intergenic
1081300977 11:41450899-41450921 TGGGAAAGATTAAAGAAGGAAGG - Intronic
1082870379 11:57938989-57939011 AGCCAAATATCAGGGGAGGAGGG - Intergenic
1082942750 11:58725807-58725829 TGGGAAGAATCAGGGGAGAATGG - Intronic
1082943015 11:58727890-58727912 AGGGAAGAATCAAGGGAGAATGG + Intronic
1083796074 11:65017545-65017567 TGGGAATGATCAAGAGGGGAAGG + Intronic
1084725739 11:70940604-70940626 GGGGAATTATCAGAGGAGGAGGG - Intronic
1084928696 11:72535990-72536012 TGGGAAAAAGGAAGGAAGGAAGG + Intergenic
1085272573 11:75278917-75278939 TGGGACAGAACAGGGGAGGATGG - Intronic
1085595647 11:77806779-77806801 AGTGAAAAAACAAGGGAGGAGGG + Intronic
1085821685 11:79800763-79800785 TGGGGGAAATCTAGGGAGGAGGG - Intergenic
1086956266 11:92937246-92937268 TTGGAGAAAGCAAGGGAGGAGGG + Intergenic
1087359918 11:97145104-97145126 AGGGACATATAAAGGGAGTATGG + Intergenic
1087973595 11:104516350-104516372 TGGGATATATAAAGAGAGAAGGG - Intergenic
1088172131 11:107010163-107010185 TGGGAAATATCTTGGAAGGCGGG - Intronic
1088350883 11:108886002-108886024 TTGGACATGTCAAGGGAAGAAGG + Intronic
1088518740 11:110670062-110670084 TTGGCAGTATCAAGGAAGGATGG + Intronic
1089230214 11:116967577-116967599 TGGGAGATGTCAAGAGATGAGGG - Intronic
1089917930 11:122177118-122177140 TGGGAAGCATCTAGGAAGGAGGG + Intergenic
1090183931 11:124723912-124723934 AGGGAAAGATGAAGTGAGGAAGG - Intergenic
1091619623 12:2076518-2076540 GGGGAAAAGTGAAGGGAGGAAGG - Intronic
1091908575 12:4210130-4210152 TAGGAAATATAATGGTAGGATGG - Intergenic
1092107175 12:5930180-5930202 TGGGTAATCACAAGGAAGGAAGG - Intronic
1092107389 12:5931458-5931480 TGGGTAATCACAAGGAAGGAAGG + Intronic
1093959855 12:25260314-25260336 TGAAAAATATTAAGGAAGGAAGG - Intergenic
1093980414 12:25469529-25469551 TGAAAAAAATCAAGGGAGAAAGG + Intronic
1094192077 12:27708183-27708205 AGGGAAAAATCAGGGGAGAAGGG + Intergenic
1097190579 12:57217550-57217572 TGGGAAATGTGATGGGAGGCTGG - Intronic
1097638824 12:62154281-62154303 TGTGATATATGAAGGAAGGATGG + Intronic
1099048594 12:77755478-77755500 AGGGAAAGAGAAAGGGAGGAAGG - Intergenic
1099718568 12:86331245-86331267 AGGGAAGAATCAAGGGAGAAGGG - Intronic
1100503931 12:95201287-95201309 AGGGAAATAGCAAGGGGGAAGGG - Intronic
1100744751 12:97633547-97633569 TGGAGAAGACCAAGGGAGGATGG - Intergenic
1101704449 12:107208654-107208676 TGGGAAAGATAAAGAGAGGAAGG + Intergenic
1103035385 12:117652444-117652466 TGGAAAATTTCTAGGTAGGATGG + Intronic
1103678959 12:122678317-122678339 AGGGAGGGATCAAGGGAGGAAGG - Intergenic
1104224763 12:126820622-126820644 TGGGACATCTCAAAGAAGGAAGG + Intergenic
1104332698 12:127862252-127862274 TGGCAACTAACAAGGGAGGTAGG + Intergenic
1104407654 12:128531764-128531786 TAGGAAAAATCAAAGGGGGATGG + Intronic
1104825710 12:131707857-131707879 TGGGAAAGATCAAGGAATCATGG + Intergenic
1105727260 13:23176811-23176833 AGGTAAACAACAAGGGAGGAAGG - Intergenic
1108186314 13:47892067-47892089 TGGGAAAGAGCTGGGGAGGAAGG - Intergenic
1108704379 13:52972035-52972057 AGGGAAAGCTTAAGGGAGGAAGG + Intergenic
1109185697 13:59265025-59265047 TGGAAATAATCAAGGGAGGTGGG + Intergenic
1109934729 13:69265644-69265666 TGGGATCTATCAAGGCAGCATGG - Intergenic
1111270283 13:85873169-85873191 TGCGAAAGATCAAGTGTGGAGGG - Intergenic
1114557792 14:23571677-23571699 TGGGAAAAAACAAGGAATGAGGG - Intronic
1117220456 14:53599416-53599438 TGAGAAAAAAAAAGGGAGGATGG - Intergenic
1118321460 14:64755726-64755748 GGGGAAATATCTATGCAGGAAGG + Intronic
1118693981 14:68365939-68365961 TGTGAAATATTTAGGCAGGAAGG + Intronic
1119646573 14:76352877-76352899 TGGGAACTAGGAAGGGCGGACGG - Intronic
1120148436 14:81004934-81004956 TGGGAAATATAATATGAGGAAGG + Intronic
1121085729 14:91144781-91144803 TGTGAAATAAAAAGGCAGGAAGG + Intronic
1124048580 15:26174474-26174496 GGGGAAAAAACAAGGCAGGAAGG + Intergenic
1124056151 15:26242527-26242549 TGGGACATATCAAGGAATGAGGG + Intergenic
1124949336 15:34302332-34302354 TAAGAAATAACAAAGGAGGATGG + Intronic
1125156970 15:36598668-36598690 AGGAAAATAGAAAGGGAGGAAGG - Intronic
1128824786 15:70703800-70703822 TGGGAAATAGCTATGAAGGAAGG - Intronic
1128945893 15:71820525-71820547 GGGGATATTTCAAGGTAGGAAGG + Intergenic
1128950254 15:71872226-71872248 TAAAAAAAATCAAGGGAGGAAGG + Intronic
1129481200 15:75827804-75827826 TGGGAGAGTTCAAGGGAGCAGGG + Intergenic
1129919304 15:79306238-79306260 TAAGAAAAATTAAGGGAGGAAGG - Intergenic
1131894264 15:97008499-97008521 AGGGAAATAGGAAGGCAGGAAGG - Intergenic
1132074245 15:98806402-98806424 TGGGACATGACAAGGGAGGCTGG - Intronic
1133063393 16:3189499-3189521 GGGGCAATTTCAAGTGAGGATGG - Intergenic
1135160906 16:20095429-20095451 TGGGACATATGCAGGCAGGATGG - Intergenic
1136499940 16:30665037-30665059 TGAGAAATATCCAGGAAAGATGG + Exonic
1136565601 16:31068102-31068124 TGGGAAGTGCCATGGGAGGAGGG - Intronic
1136636569 16:31528076-31528098 GGGGAAATACCCAGTGAGGAGGG + Intronic
1137455052 16:48611648-48611670 TTGGAAATACCAAGGGGGAATGG + Intronic
1137892114 16:52173697-52173719 TGGAAAATATCCAGTGATGATGG - Intergenic
1139158037 16:64467999-64468021 TGGGGACTGTCAAGGGATGAGGG + Intergenic
1139393520 16:66621694-66621716 GGGGAAATATGAAGGAATGAAGG - Intronic
1139511233 16:67429789-67429811 AGGGAAATCTCAGGGGAGGCTGG - Intergenic
1141759079 16:86015401-86015423 TGGAAATTCTCAGGGGAGGAGGG + Intergenic
1142913685 17:3116258-3116280 TGGGAAATTTCAATAGATGATGG + Intergenic
1143559977 17:7687780-7687802 TGTCAAATATGAAGGGTGGAAGG + Exonic
1143600898 17:7945177-7945199 TGGGAAGTATCAACGTATGAAGG - Intronic
1143996436 17:11010501-11010523 AGGCAAATTTCAAGGGAGGGAGG - Intergenic
1144023215 17:11255317-11255339 AGAGAAAAATGAAGGGAGGAGGG + Intronic
1147569253 17:41557634-41557656 TAGGGAATATCAAGGGAGATTGG - Intergenic
1148515555 17:48213662-48213684 TGGGAAACACCAAGGTAGGTTGG - Intronic
1149762423 17:59244209-59244231 AGGGAAGAATCAAGGGAGAAGGG - Intronic
1150188360 17:63210996-63211018 TGAGAAATATAAAGAGAGGGAGG - Intronic
1150882946 17:69051916-69051938 TGGGAAATAAGAATGGAGGTTGG + Intronic
1151884164 17:76913636-76913658 TGGGAAATATCAACACAGAAAGG + Intronic
1152269059 17:79313222-79313244 TGGGAATTATCAAAGGGGTAGGG + Intronic
1152292042 17:79445568-79445590 AGGGAAATCACAGGGGAGGAGGG - Intronic
1153894321 18:9544693-9544715 TGGGAGAAATCAGGGAAGGATGG + Intergenic
1154005638 18:10525312-10525334 TGGGAAAGATCACAGGAGGTTGG + Intergenic
1155073760 18:22337949-22337971 TGGGAAAATCCAAGGGAGCATGG + Intergenic
1155254401 18:23982171-23982193 AGGGAAAAAGAAAGGGAGGAAGG + Intergenic
1155672337 18:28387533-28387555 TAGGATATATCAAGGTAGCAAGG + Intergenic
1156661187 18:39348510-39348532 AGGGAAACAGCTAGGGAGGAAGG + Intergenic
1158370635 18:56798952-56798974 AGGGAAAGAAAAAGGGAGGAAGG - Intronic
1158641582 18:59208130-59208152 GGGGAAAGAAGAAGGGAGGAAGG + Intergenic
1159381144 18:67660991-67661013 GAAGAAATATCAAGAGAGGAAGG + Intergenic
1159904943 18:74081409-74081431 TGGGAAGTAGCAGGGAAGGAGGG - Intronic
1161434724 19:4256286-4256308 TGGGAAATATGGAAGCAGGAGGG - Intronic
1161874428 19:6896783-6896805 GGGGAAGTAGCAAGGAAGGAAGG - Intronic
1162664182 19:12195546-12195568 TTGGAAACCTCAAGGGAAGATGG - Intergenic
1162776200 19:12981202-12981224 TGGGAAAAATCAGGGGATGGGGG - Intergenic
1162777407 19:12988112-12988134 CGAGAAATCTCACGGGAGGAGGG - Intergenic
1163646224 19:18490752-18490774 TGGGAGATTTGAGGGGAGGAGGG - Intronic
1163763726 19:19150876-19150898 TGGGGAAAATCAAGGCAGGCTGG + Intronic
1165640834 19:37384652-37384674 TGAAGAATATCAAGAGAGGAAGG - Intronic
1166741612 19:45118032-45118054 TGGGAAAAATGAAGGGACGCTGG - Intronic
1167048258 19:47064117-47064139 TGGGAATTAACGAGGGTGGAAGG - Intergenic
925677159 2:6374682-6374704 ATGGAAATATCAAAGGAGAAAGG + Intergenic
925759780 2:7173155-7173177 TAAAAAATATCAAGGTAGGAAGG - Intergenic
925972149 2:9113360-9113382 TGGGAAAGATGCAGGGAGGATGG - Intergenic
925972154 2:9113380-9113402 TGGGAAGGATGCAGGGAGGATGG - Intergenic
925972160 2:9113400-9113422 TGGGAAGGATGCAGGGAGGATGG - Intergenic
925972166 2:9113420-9113442 TGGGAAGGATGCAGGGAGGATGG - Intergenic
925972172 2:9113440-9113462 TGGGAAGGATGCAGGGAGGATGG - Intergenic
926429848 2:12774574-12774596 TGTGAAATTTCAAGGGGGGTTGG - Intergenic
927451473 2:23212882-23212904 AGGAAAATATCAAGTGTGGATGG - Intergenic
927586438 2:24310579-24310601 TGGGCATCATTAAGGGAGGAAGG + Exonic
928915313 2:36464376-36464398 TGGGAAATGGGAAGGCAGGAGGG - Intronic
929490562 2:42392399-42392421 TGGGTAATGCCAGGGGAGGATGG + Intronic
931494198 2:62784228-62784250 TGGAAAATATCAAAAGAGGTAGG - Intronic
933035513 2:77392293-77392315 TGGGAAATCTCAAAGTGGGATGG - Intronic
934851926 2:97707154-97707176 TGGGAGATTTGAATGGAGGAGGG + Intergenic
935737267 2:106116160-106116182 TGGGAGATATCTGGGGAGGGAGG - Intronic
936405650 2:112200270-112200292 TTGGAAATAACAAAGGAGTATGG + Intergenic
937008763 2:118542904-118542926 TGGGAGCTATCAAGGCAGCAAGG - Intergenic
937137321 2:119565104-119565126 TGGGAAAAATAAAGAGAGAATGG - Intronic
938979483 2:136512601-136512623 TGGGAAGTATGTAGGGAGGAGGG - Intergenic
939992605 2:148889423-148889445 TGGGCTATATAGAGGGAGGAAGG + Intronic
941804896 2:169702055-169702077 TTGTAAATAGCAAGGAAGGATGG + Intronic
944737109 2:202577207-202577229 AGGGAAAGAGAAAGGGAGGAAGG + Intergenic
944938018 2:204589981-204590003 TGGGAAATATCAAGGGAGGAAGG - Intronic
945933206 2:215877218-215877240 TGGGAAATACCAAAGAAGTAGGG - Intergenic
946201440 2:218073009-218073031 AAGGAAAAATCAAGGGAGAAAGG + Intronic
946397825 2:219452081-219452103 AGGGAAATGCCATGGGAGGATGG - Intronic
946577907 2:221096202-221096224 TGGGAAAAATGAAGGTAGGTGGG - Intergenic
947030038 2:225782966-225782988 GGGAAGATAGCAAGGGAGGAAGG - Intergenic
947611210 2:231526153-231526175 TGGGTAAGAACAAGGCAGGAGGG - Intronic
1169388156 20:5168589-5168611 TGAGAAATATCCAGGTAGGAGGG + Intronic
1169547519 20:6665715-6665737 AGGAAAAAATGAAGGGAGGAAGG - Intergenic
1169967963 20:11238196-11238218 TGAGCAACAGCAAGGGAGGAAGG - Intergenic
1170354609 20:15478457-15478479 TGGGATGGATCAAGGGAAGATGG + Intronic
1170455321 20:16527509-16527531 TGACAAATATCAAAGGAGAAAGG + Intronic
1170894736 20:20403013-20403035 TGAGAAATGACAAGGAAGGAGGG - Intronic
1172410443 20:34717981-34718003 TGGGAACAAGCAAGGAAGGAGGG - Intronic
1172867312 20:38110164-38110186 TGGCAAATATCAAGAGAGTTTGG - Intronic
1173133981 20:40422953-40422975 AGGGAAAGAGGAAGGGAGGAAGG + Intergenic
1173353407 20:42265192-42265214 TGGGAAATACCATGGCAGGATGG - Intronic
1173943903 20:46934729-46934751 GGGGAAATAGAATGGGAGGAAGG + Intronic
1175068182 20:56308439-56308461 TGGGGAAGATCAAGGAAGGCAGG - Intergenic
1175081550 20:56424838-56424860 TGGCAAAAATGGAGGGAGGAAGG + Intronic
1176956820 21:15115270-15115292 GGAAAAAGATCAAGGGAGGAAGG + Intergenic
1176991945 21:15507775-15507797 TGGGAGAGAGCAAGGGAGGGTGG - Intergenic
1176991951 21:15507795-15507817 TGGGAGAGAGCAAGGGAGGGTGG - Intergenic
1176991957 21:15507815-15507837 TGGGAGAGAGCAAGGGAGGGTGG - Intergenic
1177559866 21:22736513-22736535 TGTAAAATATTAAGGAAGGAAGG - Intergenic
1178718900 21:34991166-34991188 TGGGATATAGCAAGAGAGGCAGG - Intronic
1181074166 22:20363910-20363932 TGGGAAATGTCTAGAGAGCAAGG - Intronic
1181327342 22:22059860-22059882 TGGGAAATATGAAGAGACTAGGG + Intergenic
1182126689 22:27821133-27821155 TGGGAAATATTAGGGAAGGGGGG + Intergenic
1183608100 22:38878744-38878766 TGGGACAAATCAAGGAATGAAGG + Intergenic
1184171476 22:42762279-42762301 TGAGAAAAAGGAAGGGAGGAAGG + Intergenic
1184230412 22:43155635-43155657 TGGGGTAGCTCAAGGGAGGAAGG - Intronic
1184760876 22:46543469-46543491 AGGGAAATAAAAAGGGAGGGAGG - Intergenic
951183657 3:19687918-19687940 TTGGAAATATCAGGGGATCATGG + Intergenic
951847294 3:27098002-27098024 TGGGAACTATCGTGGGAAGAAGG + Intergenic
952121538 3:30250290-30250312 TGGGACCCATCAAGGGAGGCTGG - Intergenic
953147198 3:40289756-40289778 TGGGAAATAAGAAAGGAGGAGGG + Intergenic
955509428 3:59664652-59664674 TGTGAAATACCCAGGGTGGAAGG + Intergenic
956838715 3:73117289-73117311 TTGGAAATATCAGGGGTGTAGGG + Intergenic
956903412 3:73740815-73740837 TGGGAGAAAGAAAGGGAGGAGGG - Intergenic
960533823 3:118794844-118794866 TGGCAAACATAAAGGGAGGGTGG + Intergenic
961905772 3:130261469-130261491 TGGGATACAGCAATGGAGGATGG - Intergenic
962381562 3:134902244-134902266 TGGGAGATATTCAGAGAGGAAGG + Intronic
962446935 3:135474231-135474253 AGGAAAATTTCAAAGGAGGAGGG - Intergenic
964219594 3:154328140-154328162 TGGGACAACTCAAAGGAGGAGGG - Intergenic
964816074 3:160719379-160719401 TGGGATCCATCAAGGGAGCAAGG + Intergenic
966202438 3:177371260-177371282 TAGGAAATGTCAAGGAAGAAAGG + Intergenic
967702740 3:192612567-192612589 TGGGAAATGTCACGGGAAAATGG + Intronic
969669692 4:8582804-8582826 TGGGAAAGATCCTGGGAGGGAGG + Intronic
970107493 4:12601446-12601468 TGGGGCCTGTCAAGGGAGGATGG + Intergenic
970303753 4:14708674-14708696 TGGGGAAAATCAAGTGGGGAAGG - Intergenic
971851347 4:31989458-31989480 AGGGAAAAATCATGGGAGAAGGG + Intergenic
972421338 4:38890107-38890129 TAGAAAATAACAAGGGAGGCTGG + Intronic
973811079 4:54570805-54570827 AGGGAAATAGGGAGGGAGGAAGG + Intergenic
973812634 4:54586711-54586733 AGGGAAGAATCAAGGGAGAACGG - Intergenic
976304789 4:83549050-83549072 TGAGAAATATCAAGTCAGGTGGG + Intronic
976513777 4:85940557-85940579 ATGGAAATGTCAAGGGAGAATGG + Intronic
977845466 4:101761840-101761862 TGGGAAAGATCACAGGAAGAAGG - Intronic
978463339 4:108982264-108982286 TGGGAAATGTCCTGGGGGGACGG + Intronic
979079439 4:116315773-116315795 TGTGAAATATATAGGTAGGAAGG - Intergenic
979130870 4:117043249-117043271 TGGCGCACATCAAGGGAGGAAGG + Intergenic
980225014 4:129971647-129971669 TGGGAAAAATCAAGGGAATTTGG + Intergenic
980608071 4:135119821-135119843 TGGGAAAACTGAAGGGTGGAAGG - Intergenic
982041907 4:151406030-151406052 AGGGTAAAATCAAGGCAGGAAGG - Intergenic
982683536 4:158460455-158460477 TGGTAAATATAAAGGGAAAAAGG - Intronic
984089353 4:175351885-175351907 TGGGATATAGCAAGGGAGAAGGG + Intergenic
986241107 5:5960848-5960870 AGGGAAAAATGAAGGAAGGAAGG - Intergenic
987733194 5:21803813-21803835 TGGGGAAAATAAAGGAAGGATGG + Intronic
988373075 5:30397397-30397419 TGTGAAATAGCAAGGGAGTAAGG - Intergenic
988764648 5:34358135-34358157 TGGGACAGTACAAGGGAGGATGG + Intergenic
989264901 5:39462217-39462239 CAGGAAGTACCAAGGGAGGATGG - Intronic
989309764 5:40001028-40001050 AGGGAAATAGGAAGGAAGGAGGG + Intergenic
989342977 5:40397287-40397309 TGGCAAGTGTCAAGGGTGGAAGG - Intergenic
989447537 5:41548278-41548300 AGGGAAATACCAAGTGAAGATGG - Intergenic
989732170 5:44662247-44662269 TGGGAAGAATGAAGGGAAGAAGG - Intergenic
990429889 5:55724399-55724421 TGGGTAAGACCAAGGGAGCAGGG - Intronic
990532745 5:56689858-56689880 TGGGAACTTTCCAGGGAAGATGG - Intergenic
991015982 5:61933125-61933147 TGAAATATATCAAGGGAGAATGG - Intergenic
991511552 5:67382893-67382915 TGGGAAATAACAAATGAGAATGG - Intergenic
991657637 5:68920109-68920131 AGGGAATAATCAAGAGAGGAGGG - Intergenic
992045949 5:72889407-72889429 TGGAAGATATTAAGGGAGGGAGG + Intronic
992165807 5:74050123-74050145 TGGTAAATATCTGGGGAGGTAGG + Intergenic
993417578 5:87654283-87654305 TAGGAAATTTCAAGGGAATATGG + Intergenic
993887228 5:93429501-93429523 AAGGAAATTTCAAGGGAGGAGGG + Intergenic
995303497 5:110614189-110614211 TGGAAATTATCAAGTGAAGAAGG - Intronic
995675476 5:114658310-114658332 TGGGCAAACTCAAGGGTGGAGGG - Intergenic
996413961 5:123189459-123189481 TGCCAGACATCAAGGGAGGAGGG - Exonic
998616201 5:143743318-143743340 TGGAAAACATCAAAGGAGAATGG + Intergenic
999343354 5:150792896-150792918 TGTGAAATAATAAGTGAGGATGG + Intronic
1001766830 5:174255699-174255721 TGGGTATTAGGAAGGGAGGAGGG + Intergenic
1002816935 6:689870-689892 TGGAAAATTTCAAGGCAGGAAGG + Intronic
1004543955 6:16578921-16578943 TGGGCAATAAGATGGGAGGATGG - Intronic
1006453449 6:34118730-34118752 TGGGAATTAGCATGTGAGGATGG - Intronic
1007269635 6:40626728-40626750 TGGGAATTTTGAAGGGAGGAAGG - Intergenic
1007847200 6:44769182-44769204 AGGGAAAAATCAGGGGAGAAAGG - Intergenic
1008036551 6:46751656-46751678 TAGGAAATAGCACTGGAGGATGG + Intronic
1008538106 6:52522904-52522926 TGGGAAATGTAAAGGCAGGCAGG - Intronic
1008706598 6:54168018-54168040 TGGGCAAAATCAAAAGAGGATGG - Intronic
1009550077 6:65079807-65079829 TGGGAAACAATAAGGGAGGTGGG - Intronic
1009568739 6:65352603-65352625 TTGGAAATAGCAAGTGATGAAGG - Intronic
1009787296 6:68356427-68356449 TGGGAAATAAAAAAGGAGCAGGG - Intergenic
1012462697 6:99481655-99481677 TGGGAGAGATTGAGGGAGGAAGG - Intronic
1013439861 6:110152901-110152923 TTGGAAACATGAGGGGAGGAAGG - Intronic
1013854666 6:114557377-114557399 TAGGATAAATGAAGGGAGGAAGG - Intergenic
1014777205 6:125524835-125524857 TGGGAATTATAAAAGGAGAAGGG - Intergenic
1015693464 6:135954040-135954062 TGGATATTCTCAAGGGAGGATGG + Intronic
1015825509 6:137306899-137306921 TGAGAATTTTCAAGGGAGAAGGG - Intergenic
1018154118 6:160969738-160969760 TGAGAAATATCAAGTGAGAGTGG + Intergenic
1018660691 6:166084027-166084049 TGGGAAGGATGGAGGGAGGAAGG + Intergenic
1018854823 6:167667773-167667795 TGGGACATATCAAGGAAGGAAGG - Intergenic
1020787748 7:12591551-12591573 TGGGAGATATCAGGTAAGGACGG + Intronic
1022637720 7:32153012-32153034 TGGAAAATATTAAGAAAGGAGGG + Intronic
1023065386 7:36372610-36372632 TGGAAATGATTAAGGGAGGAAGG + Intronic
1023583233 7:41703969-41703991 TGGTAAATAACACAGGAGGAAGG + Intergenic
1023733139 7:43210844-43210866 CGGTAAATATCAATGGTGGACGG + Intronic
1024549164 7:50546425-50546447 GGGTAAGTATCAAGGGTGGAGGG + Intronic
1024709723 7:52002049-52002071 TGGGAAACAGCAGGAGAGGAAGG + Intergenic
1026322469 7:69279723-69279745 TGGGAAGAATCAGGGGAGAAGGG - Intergenic
1027635366 7:80665916-80665938 TGGGAGAATTAAAGGGAGGAAGG + Intronic
1027865426 7:83640079-83640101 TGGGAAAGAACAAGTCAGGAGGG + Intronic
1031981834 7:128132635-128132657 TGAGAAATAAAAAGGCAGGATGG + Intergenic
1033394696 7:140962410-140962432 TGTGAAATTTGAAGGGATGAAGG - Intergenic
1033639555 7:143248326-143248348 AGGGAAAGATGAAGGGAGGAAGG - Intronic
1035824123 8:2626658-2626680 GGGGAAATACCTAGGCAGGAAGG + Intergenic
1035834494 8:2734013-2734035 AGGGAAATACCTAGGCAGGAAGG - Intergenic
1036949736 8:13129794-13129816 TTGGCAATAGCCAGGGAGGAAGG + Intronic
1037135415 8:15454129-15454151 AGGGAAGAATCAAGGGAGAAGGG + Intronic
1037352121 8:17971722-17971744 AAAGAAAAATCAAGGGAGGATGG - Intronic
1037599170 8:20379437-20379459 TGGTAAATATCTAGGGAAAAAGG - Intergenic
1037941305 8:22953047-22953069 GGGGAAAAATCAGGGGAGAAGGG - Intronic
1038070341 8:24006286-24006308 TGGGAAACAGGAAGGGAGGGAGG - Intergenic
1039317250 8:36387294-36387316 TGTGAGACATAAAGGGAGGATGG + Intergenic
1039334845 8:36577527-36577549 TGGAATATATGAGGGGAGGATGG - Intergenic
1039595833 8:38788867-38788889 TGAAAAATATCAATGAAGGAAGG + Intronic
1041194738 8:55389538-55389560 TATGAAATTTCAAGGGAAGATGG + Intronic
1041333338 8:56751995-56752017 TGGGATATATACATGGAGGATGG + Intergenic
1041409233 8:57535201-57535223 TGGAAAATGTGAAGTGAGGAGGG - Intergenic
1041721139 8:60976557-60976579 TGGGTAATGTCATGGGAAGACGG + Intergenic
1043383067 8:79723362-79723384 GGGGAAATAGAAAGGGAGGTGGG + Intergenic
1043774917 8:84254498-84254520 TGGGACATGTCATGGTAGGAGGG + Intronic
1046967795 8:120186588-120186610 AGGAAAATATCAAGGAAGGCAGG + Intronic
1047096298 8:121629741-121629763 TGGCCAATATCAAGGGGTGAGGG - Intronic
1047622018 8:126617665-126617687 TTGGAAATGTCATTGGAGGAAGG + Intergenic
1047821420 8:128525403-128525425 GAGGAAAAATCAAGGGAGGGAGG - Intergenic
1048003175 8:130396374-130396396 AGGGAAAAATGAAGGGAGGGAGG + Intronic
1048280969 8:133105498-133105520 AGGGAAATAGCAGGGGAAGAAGG + Intronic
1048708837 8:137185351-137185373 TTGGAAATATGATGGGATGAGGG + Intergenic
1048949029 8:139477795-139477817 AGGGAGAGATGAAGGGAGGACGG - Intergenic
1049901888 9:176957-176979 TTAGAAATATCAAGGGAAGGGGG + Intronic
1051160827 9:14205230-14205252 GGGGAAAAAAGAAGGGAGGAAGG + Intronic
1051606991 9:18926163-18926185 GGGGAAATATCAATGGGGGAAGG + Intergenic
1052108500 9:24549424-24549446 TGGGAAGAATGAGGGGAGGAGGG + Intergenic
1052580557 9:30349394-30349416 TGGAAAATAGCAAGAGAGCATGG + Intergenic
1053010564 9:34630560-34630582 TGGGAGAGGACAAGGGAGGAGGG - Intergenic
1056342689 9:85653213-85653235 TGGGAAACATGGGGGGAGGAAGG + Intronic
1056536107 9:87529082-87529104 TGGGAAGAATCAGGGGAGAAGGG + Intronic
1056733412 9:89184670-89184692 TGGGAGAAATCAATGCAGGAAGG + Intergenic
1058704726 9:107628804-107628826 TGGGAAATACCAACGGACAATGG - Intergenic
1059499648 9:114740067-114740089 AGGGCAAATTCAAGGGAGGAGGG + Intergenic
1059638397 9:116192446-116192468 TGGGAAGAATGTAGGGAGGAAGG - Intronic
1061457187 9:130707379-130707401 TGGGAGACACCAAGTGAGGAGGG - Intergenic
1185528479 X:798388-798410 AGGAAAATATCAAGGAAGGCAGG - Intergenic
1186713452 X:12225561-12225583 AGGGAAATAAAAAAGGAGGAGGG - Intronic
1187945874 X:24426001-24426023 TGGGAATTAGCAAGTGAGGAGGG + Intergenic
1189419930 X:40847776-40847798 TGGGAAGAATCAGGGGAGAAGGG + Intergenic
1190566396 X:51734299-51734321 TGGGACACATCAACAGAGGAAGG - Intergenic
1191899937 X:66030577-66030599 AGGGAAATATCAAGGCAGAGAGG + Intronic
1192487770 X:71545103-71545125 TGAGGAAGATGAAGGGAGGAAGG - Intronic
1193539418 X:82753381-82753403 TGGGAACTATTAAGGGTGGAGGG - Intergenic
1193829417 X:86270650-86270672 TAGAAAATATAAAGGGTGGAAGG - Intronic
1194551234 X:95302106-95302128 TGGGGCCTATCAAGGGTGGACGG + Intergenic
1194745977 X:97628734-97628756 TGTAAAATATCCAGGGAGGCAGG + Intergenic
1194898933 X:99482843-99482865 CTGGTAATACCAAGGGAGGATGG - Intergenic
1195308192 X:103606441-103606463 TGGAAAAGATCAAGGAAGGATGG + Intergenic
1195480318 X:105337550-105337572 TGGGACAAATGAAGGGGGGAGGG + Intronic
1196008113 X:110856809-110856831 TGGGAGATGTAAAGGGAAGAAGG - Intergenic
1196263133 X:113609158-113609180 AGGCAGGTATCAAGGGAGGATGG - Intergenic
1196627140 X:117889484-117889506 TGAGCAAGAACAAGGGAGGAGGG - Intergenic
1197044522 X:121979098-121979120 TGGGAAATGACAAGGGTGAATGG - Intergenic
1197777310 X:130126958-130126980 TTGGATAGATAAAGGGAGGAGGG + Intergenic
1197894887 X:131302196-131302218 AGGGAACTATTTAGGGAGGAAGG - Intronic
1198107882 X:133478226-133478248 TGGGAGACATCACGGGAAGAGGG - Intergenic
1198421387 X:136473140-136473162 GGGGAGAAATGAAGGGAGGAAGG + Intergenic
1198603025 X:138305217-138305239 TAGGAAATATCAAGTGAGATAGG + Intergenic
1199741465 X:150740058-150740080 TGGGAATGATCTAGGGAAGAGGG - Intronic
1200904840 Y:8471299-8471321 TGGGCAATGTCCAGGCAGGAGGG - Intergenic
1201887626 Y:18902910-18902932 TGGGAAATGTCATTGGAAGATGG + Intergenic