ID: 944939214

View in Genome Browser
Species Human (GRCh38)
Location 2:204605052-204605074
Sequence CTACTTTACAAGGTAACTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944939211_944939214 -2 Left 944939211 2:204605031-204605053 CCTCTTAGCAAGGTATTTGTACT 0: 1
1: 0
2: 0
3: 5
4: 93
Right 944939214 2:204605052-204605074 CTACTTTACAAGGTAACTCTGGG 0: 1
1: 0
2: 0
3: 10
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944939214 Original CRISPR CTACTTTACAAGGTAACTCT GGG Intronic
902697441 1:18149829-18149851 CTACTATAAAAGGTAGATCTGGG + Intronic
905344912 1:37304736-37304758 CTACTTTACAAGGTCATGGTGGG + Intergenic
905560747 1:38925188-38925210 ATACTTTACAATGTAATTTTGGG - Intronic
906614084 1:47223288-47223310 CTACTATACAAGGTCAACCTTGG + Intronic
910283986 1:85532716-85532738 CCACTTTAGATGCTAACTCTGGG + Intronic
914206032 1:145530269-145530291 CCACTTTAGATGCTAACTCTGGG - Intergenic
918223436 1:182456816-182456838 CTACTTCACACGGTGACTATGGG - Intronic
1065627479 10:27646780-27646802 CTACTTAACCAAGTAACCCTGGG - Intergenic
1068281838 10:54882300-54882322 TTACTTTAAAAGGTAACAATGGG - Intronic
1069585737 10:69600449-69600471 CTCTTTTACAAGGAGACTCTAGG + Intergenic
1070423599 10:76263140-76263162 TTACTTTGGAAGGTACCTCTTGG + Intronic
1072506767 10:96075602-96075624 CAACTTCATAAGGTAAGTCTGGG + Intergenic
1075807218 10:125198334-125198356 CTCCTTTCCAAAGTAACTCCTGG - Intergenic
1078389811 11:10927266-10927288 CTGCTTTGAAAGGTAGCTCTGGG - Intergenic
1078786395 11:14499047-14499069 ATACTTTAAAAGGTCACTATAGG - Intronic
1079199354 11:18361975-18361997 ATTCTTTCCAAGGTACCTCTGGG - Intronic
1082663810 11:55949257-55949279 CTTCTCTACCAAGTAACTCTGGG - Intergenic
1082902945 11:58275941-58275963 ATATTTTACAAAGTAACTATCGG + Intergenic
1085488844 11:76894573-76894595 CTCCCTTACAAGGTTACTTTGGG + Intronic
1086458249 11:86980644-86980666 CTACCTTACCATGTGACTCTGGG + Intergenic
1090023539 11:123148590-123148612 CTACTGTCCAAGGAAAATCTTGG - Intronic
1093710943 12:22329328-22329350 CTACTTTATAAGGTTGCTTTGGG + Intronic
1095218345 12:39577401-39577423 CTACCTTATCAGGTAAATCTAGG - Intronic
1097935763 12:65249425-65249447 TGACTTGACAAGGTAAGTCTAGG - Intergenic
1099123479 12:78722171-78722193 CTACTTTACAATGTCTCTCTGGG - Intergenic
1100904658 12:99284112-99284134 CTACTTTACTAGGTAAGTTTCGG - Intronic
1104721980 12:131049559-131049581 CTGATCTACAAGGTCACTCTGGG - Intronic
1106312241 13:28564201-28564223 CTCCTTTCCAGGGAAACTCTAGG + Intergenic
1108427518 13:50318894-50318916 CTACTCTACAAGGTGGCTCCTGG - Intronic
1109587959 13:64435021-64435043 CTACTTTAAATGTTCACTCTAGG + Intergenic
1109805307 13:67432116-67432138 CCACTTTAAAAAGTAATTCTGGG + Intergenic
1111794855 13:92905576-92905598 CTACTTAAGAAGGAATCTCTAGG + Intergenic
1114702670 14:24694763-24694785 CTATTTCACAGGGTCACTCTGGG - Intergenic
1115315200 14:32017805-32017827 CTTCTTTACAGGGTTACTCTGGG - Intronic
1115910441 14:38250878-38250900 CTAATTTAAAAGGTAACTGCAGG + Intergenic
1116320812 14:43460234-43460256 CTATTTTACAAGATTACTCTGGG + Intergenic
1117183243 14:53213983-53214005 CTACATTACAATGTGACCCTAGG - Intergenic
1119326974 14:73765859-73765881 CAACTTTACAAAGTAGATCTGGG - Intronic
1119673171 14:76535036-76535058 CTAGTTCACATGGTCACTCTAGG + Intergenic
1121400781 14:93675087-93675109 AGACCTTACAAGGTCACTCTAGG - Intronic
1122512381 14:102280026-102280048 CAACTGTGCAAGGTGACTCTGGG + Intronic
1123160012 14:106269005-106269027 CTATTTTAAAAGGTAATTCATGG - Intergenic
1123189724 14:106557341-106557363 CTATTTTAAAAGGTAATTCATGG - Intergenic
1123207653 14:106728559-106728581 CTATTTTAAAAGGTAATTCATGG - Intergenic
1128848139 15:70920173-70920195 GTTCTTTACAAGGGAACTCAAGG - Intronic
1131504543 15:93005079-93005101 CTATTCAACATGGTAACTCTGGG - Intronic
1131934163 15:97483162-97483184 CTCCTTTAAAAGGAGACTCTGGG - Intergenic
1132347515 15:101117274-101117296 CGACTTTAGAAGGCAAATCTTGG - Intergenic
1133350905 16:5099429-5099451 ATACTTTACAAATTAGCTCTCGG - Intergenic
1133635296 16:7659155-7659177 ATACTTCTCAAGGTAACTCTGGG - Intronic
1136680964 16:31961963-31961985 CTATTTTAAAAGGTAATTCATGG + Intergenic
1136781283 16:32903476-32903498 CTATTTTAAAAGGTAATTCATGG + Intergenic
1136870449 16:33802798-33802820 CTATTTTACAAGGTGATTCATGG + Intergenic
1136888515 16:33950364-33950386 CTATTTTAAAAGGTAATTCATGG - Intergenic
1203083938 16_KI270728v1_random:1167458-1167480 CTATTTTAAAAGGTAATTCATGG + Intergenic
1203101723 16_KI270728v1_random:1313252-1313274 CTATTTTACAAGGTGATTCATGG - Intergenic
1146845916 17:36182123-36182145 CAACTTTACAAGGACACTGTGGG - Intronic
1151919991 17:77147224-77147246 CTAAATTACAAGTAAACTCTTGG - Intronic
1153306948 18:3640053-3640075 TTAATTTAAAAGGCAACTCTGGG - Intronic
1156764864 18:40640434-40640456 CAACTCAACAAGGTAACTTTGGG + Intergenic
1157723807 18:49947068-49947090 CTACTTTTCATTGTGACTCTGGG - Intronic
1160531529 18:79567793-79567815 CTACTTTGAAAGGCAGCTCTCGG + Intergenic
927829296 2:26334744-26334766 CTACATGATAAGGTAACTATAGG - Intronic
928069513 2:28200732-28200754 CTAGTTTACCAGGTATCTATGGG + Intronic
928651811 2:33411666-33411688 CAATTTTACAAGGAAATTCTGGG - Intergenic
929704955 2:44200805-44200827 TTAATTTACAAGGTGAGTCTAGG - Intronic
933937872 2:87221012-87221034 GTACTTTAGAAGTTAACCCTTGG - Intergenic
935490571 2:103715720-103715742 CTACTTAACAATGTACCTCAAGG - Intergenic
935845240 2:107159133-107159155 TTATTTTAGAAGGTAATTCTGGG - Intergenic
936355265 2:111744760-111744782 GTACTTTAGAAGTTAACCCTTGG + Intergenic
936558080 2:113513230-113513252 ATACATTATAAGGTCACTCTAGG - Intergenic
938665001 2:133525957-133525979 CCCCTTAACAACGTAACTCTGGG + Intronic
939777147 2:146402539-146402561 CCAATTTACAAGGAAACTATAGG + Intergenic
939938601 2:148322537-148322559 CTACTTTAAAATGTAATTGTAGG + Intronic
941690778 2:168498943-168498965 TTAGTTTTCAAGGTTACTCTGGG + Intronic
942263055 2:174190830-174190852 TTACATTAGAAAGTAACTCTGGG + Intronic
942766834 2:179467261-179467283 ATACTATACTAGGTAACCCTTGG - Intronic
943381634 2:187156996-187157018 CTACCTTCCAAGTTGACTCTGGG - Intergenic
944939214 2:204605052-204605074 CTACTTTACAAGGTAACTCTGGG + Intronic
947898156 2:233694526-233694548 TTATTTTCCAAAGTAACTCTGGG - Intronic
1169106361 20:2998634-2998656 CTACCTTCCAAGGTAGGTCTTGG - Intronic
1177646664 21:23907472-23907494 ATATTTTACAAGGTAGCTATAGG - Intergenic
1178583502 21:33855019-33855041 CTGCTTTAGAGGTTAACTCTCGG - Intronic
957181117 3:76878746-76878768 CTAATTTTTAAGGTATCTCTGGG - Intronic
957288209 3:78244134-78244156 TTAGTTTTCAAGGTTACTCTAGG - Intergenic
963164380 3:142185921-142185943 CTACTTACCAAGGCAACTATTGG + Exonic
975895641 4:79086815-79086837 TTACTTTTCTAGGTAACACTTGG + Intergenic
975917006 4:79337353-79337375 CTACTTTGCAAATTAATTCTAGG - Intergenic
976424509 4:84886074-84886096 ATACATTACAATGTAACTTTTGG + Intronic
981667344 4:147245053-147245075 TTTCTCTACAAAGTAACTCTGGG + Intergenic
982952208 4:161713373-161713395 CTACTTAACCAGGAAACTCCTGG - Intronic
983353839 4:166630302-166630324 CTGCCTTGCAAGGTAACTCATGG + Intergenic
985175283 4:187193885-187193907 CAACTTTACAAGGTAAGAGTGGG - Intergenic
986274273 5:6260189-6260211 CTACTTGACTAGGAAGCTCTTGG + Intergenic
987427228 5:17787140-17787162 CTACTTGACTGGGTAACTCAGGG - Intergenic
990686264 5:58304750-58304772 CAACTTTACAGGGTAAATTTTGG - Intergenic
991384442 5:66069782-66069804 ATACTTCACAAGGAAACTATGGG - Intronic
994256197 5:97599596-97599618 CTCCTTAACAAAGTACCTCTGGG - Intergenic
994551733 5:101242194-101242216 CTTCTTAACAACCTAACTCTGGG + Intergenic
996906884 5:128610879-128610901 CTCCTTTAACAGGCAACTCTGGG - Intronic
997802850 5:136884163-136884185 CTTCTATACAAGGTAACTGGAGG - Intergenic
998549753 5:143065987-143066009 CTACTTTACCAGGGGATTCTTGG - Intronic
998837210 5:146213986-146214008 ATTCTTTAAAAGGTAACTGTTGG + Intronic
1000755933 5:165159822-165159844 CTTCTTTACAAGGTGACTTGGGG - Intergenic
1004237492 6:13887302-13887324 CTACTTTACTAGGTAGCTGTGGG - Intergenic
1011975404 6:93290083-93290105 CAAGTTTAAAAGGAAACTCTTGG - Intronic
1012607843 6:101180326-101180348 CTAATTTACAAGAAAAATCTAGG - Intergenic
1014308318 6:119769130-119769152 GTAAATAACAAGGTAACTCTAGG - Intergenic
1016455095 6:144222648-144222670 TTAGTTTTCAAGGTTACTCTGGG - Intergenic
1021911640 7:25391028-25391050 CTACTTTACAGGGTAACTGGAGG - Intergenic
1022125760 7:27355320-27355342 CTACCTTAAAATATAACTCTAGG - Intergenic
1022438329 7:30411237-30411259 CTATTTTAAAAGGGAATTCTGGG + Intronic
1022505548 7:30907023-30907045 CTCCTTCACAAGAGAACTCTCGG - Intergenic
1028321769 7:89468153-89468175 CTATTTTCCAAGCTAACGCTGGG - Intergenic
1029108451 7:98197144-98197166 CTACTTTACACGGTAAGTGCTGG - Intronic
1031486040 7:122326046-122326068 CTACTTTAAAATGTAATTTTAGG - Intronic
1032778982 7:135147130-135147152 CTACTTTGCATGGTTGCTCTGGG - Intronic
1034614534 7:152404332-152404354 CCACCTTAAAAGGTATCTCTAGG + Intronic
1035131595 7:156659771-156659793 CTACTTTACAAGATAACACAAGG - Intronic
1035860311 8:3021325-3021347 CTACCATACAAGGAAACTCTGGG - Intronic
1041052525 8:53951629-53951651 ATACTTTATAAGGTAATGCTTGG - Intronic
1042793758 8:72637631-72637653 CTTCTTTAAAAGCTAATTCTTGG + Intronic
1042900356 8:73719928-73719950 CTACTTAAAAAGAAAACTCTAGG - Intronic
1043112780 8:76209005-76209027 CTGTTTTACAAGGTCACTCCTGG + Intergenic
1046337318 8:112807122-112807144 TTTCTTTACTAGGTAACTCATGG - Intronic
1048653786 8:136512216-136512238 CTGCATTTCAAAGTAACTCTAGG - Intergenic
1049894779 9:103031-103053 ATACATTATAAGGTCACTCTAGG + Intergenic
1052353927 9:27484886-27484908 CCACTTTAGAAGGGGACTCTGGG + Intronic
1052392630 9:27898729-27898751 CTATATTCCCAGGTAACTCTTGG + Intergenic
1052972630 9:34386293-34386315 CTACTTTAAAATGTAATTCCCGG + Intronic
1053735986 9:41103027-41103049 ATACATTATAAGGTCACTCTAGG + Intergenic
1054692387 9:68328372-68328394 ATACATTATAAGGTCACTCTAGG - Intronic
1055237901 9:74146737-74146759 CTACTTTACAAGGCCACTGAGGG - Intergenic
1056263425 9:84872437-84872459 CTAATTTACAAGGCTGCTCTAGG - Intronic
1058753470 9:108062746-108062768 ATACTTTACCAGGTTACTCAAGG - Intergenic
1059683325 9:116607533-116607555 CAATTTTAAAAAGTAACTCTTGG + Intronic
1061738492 9:132680806-132680828 CTTCTTTAAAAGTTAACTTTTGG + Intronic
1186633806 X:11380267-11380289 CTACTTAAGAAGGGAAGTCTCGG - Intronic
1186777783 X:12882958-12882980 CTGCTTTACAATATCACTCTGGG + Intronic
1187936695 X:24343231-24343253 CTACTTTATATGTTAAATCTGGG - Intergenic
1189697406 X:43678703-43678725 CTACTTTAAGATGTAAGTCTTGG - Intronic
1193199566 X:78672638-78672660 CTACTTTAGAAGGGATCTGTGGG + Intergenic
1193667037 X:84333102-84333124 CTATCTTACTAGGTAACTTTGGG - Intronic
1194327007 X:92532163-92532185 CTCCTTCTCTAGGTAACTCTGGG - Intronic
1198498759 X:137221383-137221405 CTACTTTACAAAGGAACTCATGG - Intergenic