ID: 944945292

View in Genome Browser
Species Human (GRCh38)
Location 2:204677231-204677253
Sequence TCTTTTCAGTTGAGCACCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944945292_944945293 10 Left 944945292 2:204677231-204677253 CCTCTGGTGCTCAACTGAAAAGA 0: 1
1: 0
2: 0
3: 12
4: 146
Right 944945293 2:204677264-204677286 TCCAAGTCTAGATTAAAAACAGG 0: 1
1: 0
2: 1
3: 10
4: 143
944945292_944945295 19 Left 944945292 2:204677231-204677253 CCTCTGGTGCTCAACTGAAAAGA 0: 1
1: 0
2: 0
3: 12
4: 146
Right 944945295 2:204677273-204677295 AGATTAAAAACAGGTAGCATTGG 0: 1
1: 0
2: 1
3: 19
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944945292 Original CRISPR TCTTTTCAGTTGAGCACCAG AGG (reversed) Intronic