ID: 944950048

View in Genome Browser
Species Human (GRCh38)
Location 2:204738288-204738310
Sequence ACCTAAGAACATATGTAATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944950048_944950049 8 Left 944950048 2:204738288-204738310 CCGCATTACATATGTTCTTAGGT 0: 1
1: 0
2: 1
3: 10
4: 183
Right 944950049 2:204738319-204738341 TTTTTTCCTGATGTTGTAAAAGG 0: 1
1: 0
2: 18
3: 254
4: 1511
944950048_944950050 9 Left 944950048 2:204738288-204738310 CCGCATTACATATGTTCTTAGGT 0: 1
1: 0
2: 1
3: 10
4: 183
Right 944950050 2:204738320-204738342 TTTTTCCTGATGTTGTAAAAGGG 0: 1
1: 0
2: 14
3: 190
4: 1265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944950048 Original CRISPR ACCTAAGAACATATGTAATG CGG (reversed) Intronic
900872705 1:5315733-5315755 ACCTAAGAAGACATGGAAGGTGG + Intergenic
908341995 1:63191099-63191121 AGCTAAGGCAATATGTAATGGGG - Intergenic
910609494 1:89126353-89126375 ACCTAAGAAAATATTATATGAGG - Intronic
911227854 1:95326724-95326746 AAATAAAAACATATGCAATGAGG + Intergenic
911561716 1:99414619-99414641 ATTTAAGAACACATGTAATGAGG - Intergenic
914376045 1:147074799-147074821 ACCGAAGAACACATGTAAAAGGG - Intergenic
918780847 1:188698013-188698035 AGCTAACATCATATGAAATGGGG - Intergenic
918900905 1:190416013-190416035 ACTTAGGAACATATTGAATGTGG - Intronic
920610632 1:207433419-207433441 GCCTAAGAAAATATTCAATGAGG + Intergenic
922429270 1:225531876-225531898 ATCTAAAAACATTTGTAAAGAGG - Intronic
923285212 1:232487895-232487917 AACTAACAATATATGTAATTAGG + Intronic
923351187 1:233108545-233108567 CCCTAAGAACATGTCTGATGTGG + Intronic
924082786 1:240416605-240416627 ACATAAGTACAGATGGAATGAGG - Intronic
924269012 1:242312995-242313017 GCTTAAGAAGATATGTGATGAGG - Intronic
924618028 1:245630871-245630893 ACCTAGGAATAAATGTAAGGAGG - Intronic
1065274419 10:24071399-24071421 ACTTAAGAACAAATGGAAAGAGG - Intronic
1065299465 10:24308302-24308324 ATCTAACAGCATATGGAATGTGG - Intronic
1065451888 10:25868021-25868043 ACCTAAAAACATATATCATTTGG - Intergenic
1065999190 10:31088190-31088212 ACTTAAGAACAAATTTTATGAGG - Intergenic
1066522721 10:36240368-36240390 AACTAAGAACATATGATATTTGG + Intergenic
1066715894 10:38285775-38285797 GCTTAAGAAGATATGTGATGAGG + Intergenic
1067430892 10:46244682-46244704 AGCTAACATCATATGAAATGGGG + Intergenic
1067725107 10:48764232-48764254 ACCACAGAACAAATGTAACGTGG - Intronic
1067910847 10:50345149-50345171 ACCTAAGCACATATGGAAAAGGG - Intronic
1068666393 10:59680081-59680103 CCCTAGGAATATATGTAATGAGG + Intronic
1069411397 10:68157531-68157553 ACTTAAGAACAGAGGTACTGAGG + Intronic
1069585941 10:69602225-69602247 ACCTAAGAGTACATGGAATGTGG + Intergenic
1072384247 10:94908054-94908076 AGCTAACAACATATTTAATGTGG - Intergenic
1076318648 10:129562595-129562617 ACCTAATTCCATCTGTAATGGGG - Intronic
1078591174 11:12641442-12641464 TCCTAAGAGCACATGGAATGTGG - Intergenic
1081146753 11:39570287-39570309 ACTTAAAAACAAATGTAATATGG - Intergenic
1081514743 11:43816276-43816298 ACCTAAGTAGATATCTAATAGGG + Intronic
1082044250 11:47712132-47712154 AACTAAGTACTTATGTACTGTGG - Intronic
1082736464 11:56861424-56861446 ACCTAAGGACATTTCTAATTAGG + Intergenic
1084838824 11:71828330-71828352 AACTAAGAACATATGGTATTTGG - Intergenic
1086809681 11:91292990-91293012 TCCTAAGAGCATATATAAAGTGG + Intergenic
1086827866 11:91522006-91522028 ACCTAAGAAAATGTTTTATGAGG - Intergenic
1087655744 11:100920852-100920874 ACCTAAGATCTTACCTAATGAGG + Intronic
1092024772 12:5231453-5231475 TCCTAGGGACATCTGTAATGGGG + Intergenic
1092029286 12:5270531-5270553 ACTTAAGAAGATATGTATTCAGG + Intergenic
1092867532 12:12777140-12777162 CCCTGAGTATATATGTAATGTGG + Intronic
1095727327 12:45468561-45468583 ACCTAAGAAGATGTGTGCTGGGG - Intergenic
1099485169 12:83220814-83220836 ACCAAAGAAGTCATGTAATGGGG + Intergenic
1101167228 12:102050911-102050933 CCCTAAGTACCTCTGTAATGTGG + Intronic
1105254413 13:18732465-18732487 ACCTATGAATCTATGCAATGTGG + Intergenic
1105329054 13:19397760-19397782 ACATAAGAAGTTATGTAGTGGGG - Intergenic
1106099182 13:26679724-26679746 ACTTAAAAATATATTTAATGGGG - Intronic
1106368296 13:29105578-29105600 ACCTAAGAACAGAAATCATGGGG + Intronic
1107426836 13:40302396-40302418 ACCTTGTAACATATGTAATTGGG - Intergenic
1108743257 13:53361347-53361369 ACATAAGAATATATAAAATGTGG + Intergenic
1109062958 13:57643182-57643204 ACCTAACCACATGTGTAAAGTGG + Intronic
1110381627 13:74858125-74858147 ACCTAAGAATACAGCTAATGAGG - Intergenic
1111766493 13:92536971-92536993 ATCAAAGAAAATATGTAATGAGG + Intronic
1112137380 13:96596180-96596202 ACATAAGAACATATGGTATTTGG + Intronic
1113897228 13:113773153-113773175 ACCTAAGAATAAATTTAATTTGG - Intronic
1117190387 14:53284674-53284696 ACATAAGGACAAAAGTAATGAGG + Intergenic
1117865414 14:60143288-60143310 ACAAAATAACATATGTCATGTGG - Exonic
1120774079 14:88413262-88413284 ACCTAGGAAAATATCTAAGGAGG - Intronic
1123683600 15:22781917-22781939 ACCAAAGAAAATATGCAAGGCGG + Intronic
1123823895 15:24061827-24061849 ACCTGACAACAAATGTAATTTGG - Intergenic
1125683659 15:41549287-41549309 ACATAAAAATAAATGTAATGTGG - Intergenic
1129634944 15:77305504-77305526 ACTGAATTACATATGTAATGAGG + Intronic
1131759036 15:95599992-95600014 ACCAAAGTGCATATGGAATGTGG - Intergenic
1132360819 15:101213798-101213820 AACTATGTAAATATGTAATGTGG - Intronic
1132362330 15:101226924-101226946 ACCTAAAAGCATCTGTTATGGGG - Intronic
1133178798 16:4036760-4036782 ACCTAACAAAAAATGTATTGTGG - Intronic
1137679802 16:50331100-50331122 ACCTAAGAATATATGTAAAGAGG + Intronic
1139067842 16:63340769-63340791 ATTTAAGGACATACGTAATGTGG - Intergenic
1140068954 16:71633052-71633074 ACCACAGAACATATATAAAGAGG + Intronic
1146499230 17:33350197-33350219 ACCTAAGATGACATGTAATCAGG - Intronic
1147048089 17:37769631-37769653 ACCAGAGAAGATATTTAATGTGG + Intergenic
1154436615 18:14348157-14348179 ACCTATGAATCTATGCAATGTGG - Intergenic
1155317575 18:24587996-24588018 TCCTAAGATCACATGAAATGTGG + Intergenic
1155846287 18:30711730-30711752 ACCTGACAACAAATGTAAAGTGG - Intergenic
1156519572 18:37710699-37710721 ACCAAAGAACAAATTTAATAGGG - Intergenic
1157062552 18:44308796-44308818 AACTAAGATCATATGGAAAGGGG - Intergenic
1159538840 18:69749514-69749536 TCCTAAGAACATATATCCTGTGG - Intronic
1160685720 19:435811-435833 ACCGCAGAACATGTGTAAAGGGG - Intronic
930493996 2:52114361-52114383 ACCTAGGTAAATATGTCATGAGG + Intergenic
934489374 2:94749348-94749370 ACCTATGAATCTATGCAATGTGG + Intergenic
937573823 2:123394691-123394713 ATTTTAGAACAAATGTAATGTGG - Intergenic
938241654 2:129747029-129747051 AGTTAAAAACATATGTATTGTGG - Intergenic
938639150 2:133262279-133262301 TGCTAAGAACACATGTTATGTGG - Intronic
940502245 2:154507297-154507319 TCTTAAGTACATTTGTAATGGGG + Intergenic
941289473 2:163657701-163657723 ACCTACTAAAATGTGTAATGAGG - Intronic
942992987 2:182224792-182224814 ACCAATGGGCATATGTAATGTGG - Intronic
944950048 2:204738288-204738310 ACCTAAGAACATATGTAATGCGG - Intronic
945356637 2:208847947-208847969 ACATAAGAATATATTTACTGTGG - Intronic
945422150 2:209651682-209651704 CCCTAAGAACATATTTAAACAGG - Intronic
946360322 2:219215825-219215847 TCCTAATAACTTAGGTAATGCGG - Intronic
947409915 2:229826226-229826248 AACTAAGTACCTATGTAATAGGG - Intronic
947936840 2:234012714-234012736 AACTAAAATCATATTTAATGGGG - Intronic
1168858567 20:1028385-1028407 AGCTAAAAATATATTTAATGTGG + Intergenic
1169301820 20:4449016-4449038 ACATAATAACATATTTTATGAGG - Intergenic
1169458205 20:5771581-5771603 AACTAAGCACTTATGTACTGTGG + Intronic
1170245005 20:14210965-14210987 AGCTAAGACCATATGCATTGAGG + Intronic
1174287898 20:49484812-49484834 ACATCAGTACATATGCAATGTGG + Intergenic
1176840428 21:13837498-13837520 ACCTATGAATCTATGCAATGTGG + Intergenic
1178060223 21:28845381-28845403 AGCTAAGAAAATATGCAAAGGGG - Intergenic
1183842601 22:40512419-40512441 ACCTAGAAACATACCTAATGAGG + Intronic
949163033 3:904685-904707 AGCTAAGATCACATTTAATGGGG + Intergenic
953576524 3:44117128-44117150 ACCTAATAAAATATAAAATGGGG + Intergenic
956065059 3:65389204-65389226 AATTAGGAAAATATGTAATGTGG - Intronic
956196314 3:66656552-66656574 ACCTAAGAACATCAGTCATTTGG - Intergenic
956440393 3:69275018-69275040 ACAGAAGAACATATGGCATGAGG + Intronic
958964858 3:100547867-100547889 AACTAAGAACAAATGTCATATGG - Intronic
960177946 3:114539463-114539485 ACCTTAGGACATAAGCAATGTGG + Intronic
961071326 3:123930633-123930655 ACCCAAGATCATATGGCATGAGG + Intronic
961758727 3:129148863-129148885 ACCAAAGAAAATATGTAGGGTGG - Intronic
962073877 3:132059935-132059957 ACATAATAACATTTGCAATGAGG - Intronic
962944160 3:140152418-140152440 CCCTAAGAATATATGTCAAGGGG - Intronic
963554055 3:146763622-146763644 TCCTAAGAAAATATATAATTAGG + Intergenic
965254723 3:166391286-166391308 AGCTAACATCATATTTAATGTGG - Intergenic
965904189 3:173682644-173682666 ACCTAAGAACTTAAATAATTGGG + Intronic
966526738 3:180927872-180927894 ACCTAAGAATATTTGAATTGGGG + Intronic
970416301 4:15861203-15861225 ACATAAGAACAGATGTGATATGG + Intergenic
971444968 4:26733766-26733788 ACCAAAGAAGAAATGTAATAGGG + Intronic
974963056 4:68727400-68727422 ACCTAAGAACATACTTAACCAGG - Intergenic
976546131 4:86337737-86337759 ACCCAAGAACAGATGTGCTGAGG + Intronic
977008705 4:91607568-91607590 ACCTAAGAATAGATGTTGTGTGG + Intergenic
978193615 4:105945045-105945067 ACCTAAAAATTTATGAAATGAGG - Intronic
980754661 4:137142305-137142327 ACTCAAGCACATTTGTAATGAGG + Intergenic
981655655 4:147110039-147110061 ACCTAATAATACATGTAAAGTGG - Intergenic
983272392 4:165578303-165578325 AACTAAGAAGATTTGTAATGGGG - Intergenic
984024929 4:174531320-174531342 TCCTAAGAATTTATGAAATGTGG - Intergenic
984068231 4:175077322-175077344 GCCCAAGAACATGTGAAATGAGG - Intergenic
984292315 4:177810884-177810906 AACTAAGAACATATGCCATATGG - Intronic
984297062 4:177865812-177865834 ACCTAAGGCCATAGGTAATCTGG - Intronic
984967376 4:185151568-185151590 ACTTAAGATTATATGTTATGTGG - Intergenic
985195848 4:187428474-187428496 ACCTAAGGAGAGATGTCATGCGG + Intergenic
986409786 5:7465802-7465824 AGCTTAGAATATATGTAATGGGG + Intronic
988174274 5:27701404-27701426 ACCTAAGAATATATGAAATTTGG - Intergenic
989312064 5:40031200-40031222 ACCAAAGAACATATGTATAAAGG - Intergenic
989746418 5:44835345-44835367 ACTTAGGAAAAGATGTAATGGGG + Intergenic
994139532 5:96326391-96326413 ATATAAAAACACATGTAATGGGG - Intergenic
995547145 5:113244188-113244210 CCCAAATAGCATATGTAATGTGG + Intronic
996491975 5:124108393-124108415 AACTATAAACATATGTAGTGGGG + Intergenic
996771152 5:127087251-127087273 ACCCAGGAAGAAATGTAATGGGG - Intergenic
996887409 5:128374017-128374039 AACAAATAAGATATGTAATGGGG - Intronic
1000654117 5:163855144-163855166 TCCTATAAACATAAGTAATGTGG - Intergenic
1003562343 6:7191988-7192010 AACTAACATCATATTTAATGGGG - Intronic
1003857012 6:10286845-10286867 TCATAAGCACATCTGTAATGTGG - Intergenic
1004246942 6:13987362-13987384 AGCTACAAAAATATGTAATGAGG + Intergenic
1005227710 6:23661651-23661673 ACAAAAGTACATATGTATTGTGG - Intergenic
1008891253 6:56493813-56493835 ACATGAGAACATATTTAAAGGGG - Intronic
1009592930 6:65697035-65697057 GCCTCAGAATATATGTAATCTGG - Intronic
1010245234 6:73656141-73656163 GCCTAAGGAGACATGTAATGTGG - Intergenic
1010734676 6:79430626-79430648 ACCCAGGAAAATATGCAATGTGG + Intergenic
1011188792 6:84708555-84708577 ACCTCAGATCATATGTAGGGAGG + Intronic
1011415094 6:87110301-87110323 ACCTAAAAAATTATGTTATGGGG + Intergenic
1016732529 6:147442276-147442298 AGCTAAGCACATCTGTAATCAGG - Intergenic
1020378754 7:7518228-7518250 ACTTAAGAAAATATATTATGTGG + Intronic
1022152554 7:27623286-27623308 AGCTAACATCATATGGAATGGGG + Intronic
1022265656 7:28751831-28751853 ACATAAAAACAAATGCAATGTGG - Intronic
1023186239 7:37536246-37536268 ACCTAAGAAAATCCATAATGGGG - Intergenic
1023707657 7:42958805-42958827 ACATTATAACATATGTAATTGGG - Intergenic
1024723876 7:52170144-52170166 ACCTGAGATCATATGTCATTAGG + Intergenic
1028049820 7:86170180-86170202 ACCAAAATACATATTTAATGTGG + Intergenic
1029360343 7:100083774-100083796 AACTAAGAAGATAAGAAATGAGG + Intergenic
1031270019 7:119636440-119636462 ACCAAAAAAGATATGTGATGAGG - Intergenic
1036277670 8:7369794-7369816 AACTAAGAACATATGGTATTTGG - Intronic
1036343856 8:7942128-7942150 AACTAAGAACATATGGTATTTGG + Intronic
1036839197 8:12102895-12102917 AACTAAGAACATATGGTATTTGG + Intergenic
1036860986 8:12349138-12349160 AACTAAGAACATATGGTATTTGG + Intergenic
1037052288 8:14391107-14391129 AATTAAGGACATATGTAATTGGG - Intronic
1037493877 8:19420572-19420594 CCCTGAGAAAATATGTAATCAGG + Intronic
1038033927 8:23670709-23670731 ACCTCAGAACATACATATTGTGG - Intergenic
1040747694 8:50665247-50665269 AACTAAGTAGATATGTTATGCGG + Intronic
1043069002 8:75614480-75614502 ACATATGAACATATGAACTGTGG - Intergenic
1043564777 8:81535681-81535703 ACTTGAGAAAATATGCAATGAGG - Intergenic
1045269224 8:100648039-100648061 AACCAAGAACAGTTGTAATGTGG - Intronic
1047284797 8:123478845-123478867 AACTAAGAACATATGTTATATGG - Intergenic
1048196925 8:132339034-132339056 TCCCAAGAACTTTTGTAATGCGG - Intronic
1053469613 9:38336763-38336785 ACCACAGAACATAGGTAATGAGG + Intergenic
1053668408 9:40334932-40334954 ACCTATGAATCTATGCAATGTGG - Intergenic
1053918210 9:42961229-42961251 ACCTATGAATCTATGCAATGTGG - Intergenic
1054379551 9:64474984-64475006 ACCTATGAATCTATGCAATGTGG - Intergenic
1054516204 9:66041361-66041383 ACCTATGAATCTATGCAATGTGG + Intergenic
1056653595 9:88490421-88490443 CCCTAAGGACTTATGTACTGAGG + Intergenic
1058916584 9:109572597-109572619 ACCTAGGAATATACCTAATGAGG + Intergenic
1186994280 X:15103198-15103220 ACCTAAAAACATATGTAAACAGG - Intergenic
1187214182 X:17259787-17259809 ACCTAAGAATAAACTTAATGAGG + Intergenic
1187790660 X:22946494-22946516 ACCTAAGTACATAAGTACTATGG - Intergenic
1188369100 X:29347223-29347245 AACTAAGAACTTATATACTGTGG + Intronic
1189630712 X:42949798-42949820 ATCTAAGAACAGATGTACTATGG + Intergenic
1193163022 X:78249815-78249837 ACCTAGGAATATATTTAATCAGG - Intergenic
1193539047 X:82748124-82748146 ACATATGAACATGTGAAATGAGG - Intergenic
1194344521 X:92746919-92746941 GCCTAAGAATATAGCTAATGAGG - Intergenic
1194789720 X:98132171-98132193 TCCCAAGAAAATTTGTAATGTGG + Intergenic
1194885534 X:99311528-99311550 ACCTCAGAACACACGGAATGGGG - Intergenic
1195568656 X:106374814-106374836 ACCTAAGAATACAGCTAATGAGG + Intergenic
1196206472 X:112945922-112945944 ACCTAAGATTATATCTACTGTGG + Intergenic
1197731509 X:129814153-129814175 ATCTAAGAGCAGATGTGATGTGG - Intronic
1198761176 X:140033915-140033937 ACCTAAAAACAGATGTCATAAGG + Intergenic
1200652865 Y:5863559-5863581 GCCTAAGAATATAGCTAATGAGG - Intergenic