ID: 944955013

View in Genome Browser
Species Human (GRCh38)
Location 2:204798632-204798654
Sequence CCCAACCTCCTCAAGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 1, 2: 2, 3: 27, 4: 220}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944955013_944955019 10 Left 944955013 2:204798632-204798654 CCATCCTGCTTGAGGAGGTTGGG 0: 1
1: 1
2: 2
3: 27
4: 220
Right 944955019 2:204798665-204798687 GAGGACTTTCTATTACAACTTGG 0: 1
1: 1
2: 18
3: 193
4: 618
944955013_944955018 -9 Left 944955013 2:204798632-204798654 CCATCCTGCTTGAGGAGGTTGGG 0: 1
1: 1
2: 2
3: 27
4: 220
Right 944955018 2:204798646-204798668 GAGGTTGGGGGAGAGTAAAGAGG 0: 1
1: 0
2: 8
3: 83
4: 768

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944955013 Original CRISPR CCCAACCTCCTCAAGCAGGA TGG (reversed) Intronic
901069107 1:6508440-6508462 CCCAGCCTCCCGATGCAGGAAGG + Intronic
904251463 1:29227609-29227631 CCACACCTCTGCAAGCAGGAGGG - Intronic
907300965 1:53486016-53486038 CCCGACCTCCACAAGCACGTGGG + Intergenic
907750788 1:57261186-57261208 CCCAACCTCCGCAAGAAACACGG + Intronic
908426463 1:64012514-64012536 CTCAACATCCTCATGCATGAAGG + Intronic
912956211 1:114155411-114155433 ACCAAACACCTCCAGCAGGAAGG - Intergenic
913529601 1:119724373-119724395 CAGATCCTCCTCCAGCAGGAGGG - Intronic
913559337 1:120001879-120001901 CCCAACATCCTGAAGCAGAACGG + Intronic
913638524 1:120788663-120788685 CCCAACATCCTGAAGCAGAACGG - Intergenic
914279933 1:146161322-146161344 CCCAACATCCTGAAGCAGAACGG + Intronic
914394311 1:147250482-147250504 CCCACCCTCACCCAGCAGGATGG - Intronic
914434854 1:147650675-147650697 CCCAAACTCCAAAAGAAGGAAGG - Intronic
914540972 1:148612240-148612262 CCCAACATCCTGAAGCAGAACGG + Intronic
914625670 1:149459006-149459028 CCCAACATCCTGAAGCAGAACGG - Intergenic
914716398 1:150258142-150258164 CCAAATCACCTCCAGCAGGAGGG - Exonic
914719979 1:150281880-150281902 CCCACCCTCCTCACCCAGCAGGG + Intergenic
916203215 1:162291090-162291112 CCCAATCTTCTAGAGCAGGAGGG + Intronic
920439350 1:205968558-205968580 CTCAAACTTCTCAAGCAGGAGGG + Intergenic
921064273 1:211611651-211611673 ACCAACCTCCTGAGGCAGAAGGG + Intergenic
923105891 1:230853418-230853440 GCAAATCTCTTCAAGCAGGATGG + Intronic
924179117 1:241423967-241423989 CCCACCCTCCTGCAGCAGGGTGG + Intergenic
1062922167 10:1288713-1288735 CCCAAACTCCTGGAGCAGGCAGG + Intronic
1063052799 10:2471271-2471293 AGAAACCTCCTCAAGCAGGGAGG + Intergenic
1065563022 10:26982362-26982384 CCCAAACTCATCAAGCAAAAAGG - Intergenic
1065918450 10:30370997-30371019 CCCAACCTCCTCCCACAGCAGGG - Intronic
1067711810 10:48656219-48656241 CCCCGCATCCTCAGGCAGGACGG + Intronic
1068018919 10:51555949-51555971 CCCCATTTTCTCAAGCAGGAAGG + Intronic
1068335830 10:55631153-55631175 CCCAACCTCCCCCAGCACGGCGG + Intergenic
1068680207 10:59811062-59811084 CCCAACAACCTCCAGAAGGATGG + Intronic
1069595072 10:69665094-69665116 CCCACCCACCTCATTCAGGAGGG + Intergenic
1069921750 10:71819775-71819797 GCTGACCTCCTCCAGCAGGATGG + Exonic
1070838612 10:79467823-79467845 CCCAACCTCCTCAGGCTCCAGGG + Intergenic
1072049165 10:91686602-91686624 CCAAACCATCTCAAGCAGAAAGG + Intergenic
1072612732 10:97029554-97029576 CCCAACCTCCAGAATTAGGATGG + Intronic
1072664521 10:97384108-97384130 CCCAACCTCAGCAGCCAGGACGG + Intronic
1072664542 10:97384182-97384204 CCCAACCTCAGCAGCCAGGATGG + Intronic
1072664657 10:97384592-97384614 CCCAACCTCGGCAGCCAGGACGG + Intronic
1072664693 10:97384741-97384763 CCCAACCTCGGCAGCCAGGATGG + Intronic
1073256850 10:102157771-102157793 CCCAAACTCCTCAAGCAGAATGG - Intronic
1074925285 10:118062792-118062814 CACAACCTCCTCAGGTGGGATGG + Intergenic
1075237203 10:120741609-120741631 CCCAGCCTGCTCAGGCAGCAGGG + Intergenic
1076811887 10:132890641-132890663 CCCAAACTCCTCAGGGAGGTGGG + Intronic
1077116608 11:887998-888020 CACGACATCCCCAAGCAGGAAGG + Intronic
1077326773 11:1967381-1967403 CGCCCCCTCCTCCAGCAGGACGG - Intronic
1077593701 11:3513491-3513513 CCCAAATTCCTCAAGTAGAAAGG - Intergenic
1077891701 11:6422723-6422745 CCCAATCTCATTGAGCAGGAAGG + Intergenic
1078549930 11:12272972-12272994 CCCCACCAACTCCAGCAGGAAGG + Intergenic
1080805356 11:35648133-35648155 CACAAGATCCTAAAGCAGGAAGG + Intergenic
1082769425 11:57195333-57195355 CCCAACCCCCTCAACATGGAAGG + Intergenic
1084273969 11:68042643-68042665 CCGCACCTCCTCCTGCAGGAAGG - Exonic
1085053695 11:73392390-73392412 TGCAACCTCCTCAAGCGGAAGGG + Exonic
1090850020 11:130563936-130563958 CCCAAGCTCCTCCCGGAGGAAGG - Intergenic
1091078392 11:132642701-132642723 CCCAACCTCATGAAGAAGGTGGG + Intronic
1202809754 11_KI270721v1_random:22561-22583 CGCCCCCTCCTCCAGCAGGACGG - Intergenic
1094059413 12:26297632-26297654 CCAAACCACCTTAAGCAAGAAGG + Intronic
1095907125 12:47389942-47389964 CTCAGCCTCCTCAAGCAGCTAGG + Intergenic
1096234116 12:49914173-49914195 CCCAAGTTCCTGAAGCAGTACGG - Intergenic
1096327600 12:50678693-50678715 CCCAACCAGCCCAAGCCGGAGGG + Exonic
1096657607 12:53101452-53101474 CCACACCTCCTGAATCAGGAAGG - Intronic
1098690414 12:73480904-73480926 CCCAACCTCCACAGAAAGGAGGG - Intergenic
1103221840 12:119252799-119252821 CCCAACCTGATTATGCAGGAAGG - Intergenic
1103909988 12:124346778-124346800 GCCAAGCTCCTAAAGCGGGAGGG - Exonic
1103997301 12:124838668-124838690 CCCAACCCATTCAAGCAGGAGGG + Intronic
1104280142 12:127369390-127369412 CCCAGCCTCCTCAGACAAGAAGG + Intergenic
1104429989 12:128708368-128708390 CTCAAACTCAGCAAGCAGGAGGG + Intergenic
1105540580 13:21312727-21312749 TCCAACCTCCTCAGGAAGGATGG + Intergenic
1105782862 13:23719689-23719711 ACCAACCTTCCCAAGCAAGAGGG - Intergenic
1112671614 13:101645753-101645775 CGCAACTGCCTCACGCAGGAGGG + Intronic
1114530500 14:23392648-23392670 CCCACCCTTCTCCTGCAGGAAGG - Exonic
1114758077 14:25282607-25282629 CCCATCATCCTGAAGCAGGTGGG - Intergenic
1116530833 14:45971451-45971473 ACTGACCTCCTCAAGCAAGAAGG + Intergenic
1118807191 14:69248450-69248472 CCCAACCCTCTCAAGTAGGAAGG - Intergenic
1118807287 14:69249480-69249502 CCCAACCCTCTCAAGTAGGAAGG + Intergenic
1119382374 14:74237418-74237440 TCCAACCTCCTACAGCAGGATGG + Intergenic
1119973608 14:79000690-79000712 CGCAACCTCCACCAGCAGCAGGG - Intronic
1122691250 14:103533076-103533098 CCCAACCCCCTGATGGAGGAAGG + Intronic
1122775763 14:104116471-104116493 CCCTACCCCCTCACGCAGCAAGG - Intergenic
1122852804 14:104546088-104546110 CCCACACTCCACAAGCGGGAGGG + Intronic
1122886689 14:104713431-104713453 CCCACGCTCCTCAGTCAGGAAGG + Exonic
1123666870 15:22614888-22614910 TCCAACCTCCTCCTCCAGGAGGG - Intergenic
1123989165 15:25670447-25670469 CACAGCCTCTTCCAGCAGGAGGG + Intergenic
1124320710 15:28709461-28709483 TCCAACCTCCTCCTCCAGGAGGG - Intronic
1124577836 15:30925461-30925483 CCCAGTCTCCTCAGGGAGGAGGG - Intronic
1125377833 15:39052076-39052098 CCCAACTCCTTCAAGCAGTAGGG - Intergenic
1126343186 15:47666266-47666288 CCCAGCTTCCTGAAACAGGAAGG - Intronic
1127958083 15:63870612-63870634 GCCAACCTCCTCTTCCAGGAAGG + Intergenic
1128715430 15:69904427-69904449 CCTAACCTCCGAAAGCAGAAGGG - Intergenic
1129332155 15:74833252-74833274 CCCAAACCCCTTCAGCAGGAGGG + Intergenic
1131066063 15:89435736-89435758 CCCAGGCTCCTCAAGAAGGCAGG + Intergenic
1132059634 15:98681596-98681618 ACCAACCACCCCAGGCAGGAGGG - Intronic
1132673754 16:1113286-1113308 CAGAAACTCCTCAACCAGGAAGG - Intergenic
1132955371 16:2589570-2589592 CTCAACCTCCCCAAGCAGCTAGG - Intronic
1133396825 16:5454085-5454107 CCCAAACTCCTCATACAGGCTGG - Intergenic
1133502542 16:6379457-6379479 CCCAACCTTCTCATGCGGGTAGG - Intronic
1133993159 16:10726566-10726588 CCCAACCAACTCAAACAGGCAGG - Intergenic
1134262166 16:12660125-12660147 CCAAACCATATCAAGCAGGAAGG + Exonic
1137695120 16:50456431-50456453 TCCCACCTCACCAAGCAGGAGGG + Intergenic
1139536371 16:67577299-67577321 CTCAACCTCCTCAAGTAGCTGGG - Intronic
1140454012 16:75094062-75094084 CCCCACCTCCCCAAGGAGGGCGG - Intronic
1141655860 16:85416277-85416299 CCCTCCCTCCTCCAGCAGGCTGG - Intergenic
1141720382 16:85752265-85752287 CCCACCCTCCGGAGGCAGGATGG + Intergenic
1141946667 16:87315489-87315511 CGCAACACCCTCAGGCAGGAAGG + Intronic
1142474065 17:179721-179743 CCCAATCTCCCCAAGCTGGCAGG + Intronic
1144595540 17:16567414-16567436 CCTAACCTCACCAGGCAGGATGG + Exonic
1145002248 17:19313435-19313457 GCCACCATCCTCAAGGAGGAGGG - Intronic
1147381030 17:40056387-40056409 CCAAAGCTTCTAAAGCAGGAAGG + Intronic
1147609783 17:41794636-41794658 CCCAGCCTCCTCCTCCAGGAAGG + Intergenic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1148623645 17:49053148-49053170 CCCAACTGCCTCCAGAAGGAGGG - Exonic
1148722252 17:49762803-49762825 GCCAACCTCCTCATGCAAGTAGG + Intronic
1149446587 17:56717869-56717891 CCCAGCCTCCTCCAGCTGGTAGG - Intergenic
1151933219 17:77246597-77246619 CCCAACGTCCTTTAGCACGAAGG + Intergenic
1152770283 17:82163326-82163348 CCCAAGCTGGTCAAGCCGGAGGG - Exonic
1157121715 18:44917615-44917637 CCCATCCACCCCCAGCAGGAGGG + Intronic
1157934139 18:51855341-51855363 CCATACCTCCTGAAGCAGCAGGG + Intergenic
1159555324 18:69939808-69939830 ACCAGCCTCCCCAAGCAAGAGGG + Intronic
1160812747 19:1020063-1020085 CCTGAGCTCCTGAAGCAGGAAGG + Intronic
1160944885 19:1637064-1637086 CGCAACCTCCTCCACCAGCACGG + Intronic
1164386599 19:27776368-27776390 GTCAACTTCATCAAGCAGGAAGG - Intergenic
1164610410 19:29627902-29627924 CCCAGCCTCCTCCCACAGGACGG - Intergenic
1166711550 19:44940896-44940918 CCCAGTGTCCTCATGCAGGACGG - Intergenic
1167304347 19:48698364-48698386 CCCTACCTCCTTACCCAGGAAGG - Intronic
1167697555 19:51024263-51024285 CACAACCTCCAGAAGGAGGAGGG - Exonic
1168054857 19:53857430-53857452 GCCAAGCTCTTCATGCAGGATGG + Intergenic
925404101 2:3594938-3594960 CCCACACTCCCCAGGCAGGACGG + Intronic
927316317 2:21687221-21687243 ACGATCCTCCTCAAACAGGAAGG + Intergenic
928067674 2:28182904-28182926 CCCAATCTTTTCAAGCACGAGGG - Intronic
928334279 2:30382866-30382888 CCCTACCCCCTCAAGCAGCCTGG + Intergenic
929245259 2:39695372-39695394 CCCAAGTTCCTTAAGCAGGGAGG - Intronic
929738845 2:44581055-44581077 CACAACCACAGCAAGCAGGATGG - Intronic
933170053 2:79115114-79115136 CCCCACTGCCCCAAGCAGGATGG + Intergenic
935739086 2:106130809-106130831 CCCAACACCCTGAAGCAGGCTGG + Intronic
936026559 2:109035190-109035212 CCCAACCTTCTCAAGTGTGATGG + Intergenic
936492338 2:112983098-112983120 CCAGTCCTCCTCAAGCAGGGAGG + Intronic
936934398 2:117825293-117825315 CGCAAGCCCCTCAAGGAGGATGG - Intronic
938693674 2:133815682-133815704 CCCATCCCCCTCGAGCAGCAGGG + Intergenic
939483980 2:142785957-142785979 ACCAGCCTCCCCAAGCAAGAGGG + Intergenic
939732924 2:145807824-145807846 CACAACCTCCTCAGACGGGAGGG + Intergenic
940447904 2:153799359-153799381 CCCAGCCTCCTCAACCAGAATGG + Intergenic
941703374 2:168629930-168629952 CTCAACCTCCTCAAGTAGGTGGG + Intronic
943754590 2:191544849-191544871 ACCAACCCCCTCAGGCAGAATGG - Intergenic
944955013 2:204798632-204798654 CCCAACCTCCTCAAGCAGGATGG - Intronic
946186574 2:217984041-217984063 ACCAACCTCCCCAAGCAAGAAGG + Intronic
946446650 2:219745844-219745866 CCCAACCTCCTCATTCTGGAGGG - Intergenic
948925689 2:241095328-241095350 GCCAACTTCCCCAAACAGGAAGG + Exonic
1169266014 20:4167809-4167831 CCCAGCCTCCTCACTCAGGCTGG - Intronic
1169351726 20:4873523-4873545 AGCAACCTGCTCAAGCATGATGG - Intronic
1171949272 20:31406333-31406355 CCCAGCCTCCTCAGGCAGTGTGG - Intronic
1174489658 20:50883958-50883980 GCCAGCCTCTTCAACCAGGAGGG + Intergenic
1175705307 20:61172327-61172349 CCCAGCCTCCTCGAGCCTGATGG + Intergenic
1176047539 20:63100639-63100661 CCCAGCCACCCCCAGCAGGATGG - Intergenic
1177197814 21:17921230-17921252 ACCAGCCTCCTCAAGCAAGAGGG - Intronic
1179454272 21:41488198-41488220 CCCAACCTCACCCAGCAGGTGGG - Intronic
1179953314 21:44723886-44723908 CCCCAGCGCCTGAAGCAGGATGG + Intergenic
1181062902 22:20290511-20290533 CCCATCTTCCTCCAGCAGCACGG - Intergenic
1181167945 22:20993303-20993325 CCCAACCTCCTCCAGGAAGCTGG - Intronic
1181360135 22:22327856-22327878 CCCTTCCTCCTCTACCAGGAGGG + Intergenic
1181532828 22:23526738-23526760 CCCAGCCGCCTCAGCCAGGAAGG + Intergenic
1182427891 22:30284478-30284500 CCCAGCCTCACCAAGCAGGGAGG + Intergenic
1183263320 22:36810407-36810429 CCCAACCCCCTAACGCAGGAAGG - Intronic
1183344325 22:37298805-37298827 CCCCAGCTCCTGAAGCAGGAAGG - Intronic
1183573918 22:38674977-38674999 CCCAACACCATGAAGCAGGAGGG - Intergenic
1185276902 22:49953777-49953799 CCCAACATGGTCAAGCAGGAAGG + Intergenic
950323980 3:12087634-12087656 CTCAACCTCCCCAAGCAGCCGGG - Intronic
951620610 3:24597945-24597967 CCCAAGGTCCTGAAGCTGGATGG - Intergenic
952059849 3:29494750-29494772 ACCAACCTTCAAAAGCAGGAAGG - Intronic
953543600 3:43843754-43843776 ACCATGCTCCTCAAGCAGGTTGG + Intergenic
955216858 3:56991169-56991191 CCCAGACTCCTCCAGCATGAAGG + Intronic
956953200 3:74306494-74306516 CCCCACCTCCTCAAGCAGGAAGG + Intronic
958958595 3:100488030-100488052 GCCAAACTTCTCAAGAAGGATGG + Intergenic
959463724 3:106658737-106658759 CCAAACCACATCAAGCAGTATGG + Intergenic
959516062 3:107268547-107268569 CTCAACTGCCTCAGGCAGGAAGG - Intergenic
961508238 3:127385675-127385697 CCCAACAGCCTCTAGCAGGCAGG - Intergenic
961897490 3:130180807-130180829 CCCAAATTCCTCAAGTAGAAAGG - Intergenic
964165091 3:153694744-153694766 ACAAAGCTCCTGAAGCAGGAGGG - Intergenic
964668564 3:159200573-159200595 ACCACCATCCTCCAGCAGGAAGG + Intronic
968787154 4:2631099-2631121 GCCGTACTCCTCAAGCAGGAGGG - Exonic
969007659 4:4034379-4034401 CCCAAATTCCTCAAGTAGAAAGG - Intergenic
969443839 4:7233101-7233123 CCCAGCCTCCTCCATCAGGAAGG - Intronic
969745950 4:9071684-9071706 CCCAAATTCCTCAAGTAGAAAGG + Intergenic
973912400 4:55594260-55594282 TCCCACCTCCTCCATCAGGAAGG - Intergenic
975905892 4:79211622-79211644 CCCACCCCCCACAAGCTGGAGGG + Intergenic
976319588 4:83698399-83698421 CCCAATGCCTTCAAGCAGGAAGG + Intergenic
981141581 4:141275709-141275731 ACCAACCTCCAGAGGCAGGAAGG - Intergenic
982224345 4:153152515-153152537 CTCAATCTTGTCAAGCAGGAAGG - Intronic
984924498 4:184794776-184794798 CCCCGCCTCCTCAAGGATGAAGG - Intronic
985766928 5:1785000-1785022 CCTCACCTCCTCAAGGAAGAAGG + Intergenic
986797054 5:11222873-11222895 TCCCACCTCCTGAAGCAGGCTGG + Intronic
987203153 5:15597734-15597756 CCCAAACTCTTCTAGCATGAAGG - Intronic
987309556 5:16669101-16669123 CCAAACCTGGACAAGCAGGAGGG + Intronic
988457602 5:31400368-31400390 CCCAAGCTCCTCAAGGACCAGGG + Intergenic
989205298 5:38804079-38804101 CCCAGCTTCCACATGCAGGAAGG + Intergenic
992259430 5:74954853-74954875 CTCAACCTCCCCAAGCAGCTGGG - Intergenic
993646873 5:90473838-90473860 CCCACCCTCATCCTGCAGGATGG - Exonic
998042987 5:138965097-138965119 CCCCACCTCCCCAGGCAAGAGGG - Intronic
998512899 5:142728520-142728542 CTCAGCCTCCTCAAGAATGAGGG - Intergenic
998737417 5:145158442-145158464 CCTCACCTCCTCAGGTAGGAGGG + Intergenic
999186556 5:149714996-149715018 CCCAAGCTCCTGCGGCAGGAAGG - Intergenic
999437061 5:151571225-151571247 CCCAGCCCCCACAAGCAGAAGGG + Intergenic
999763669 5:154722245-154722267 CCCTACCTCCTCCTGCAGGGAGG + Intronic
1001249577 5:170136404-170136426 CCCAACCCCCAAGAGCAGGATGG - Intergenic
1001929691 5:175664131-175664153 CCCAACCTCCAAGAACAGGAGGG + Intronic
1002616892 5:180461607-180461629 CCCACTCTCCCAAAGCAGGAGGG - Intergenic
1006147664 6:31969072-31969094 CCAAACACCCTCAAGCAGGTAGG + Exonic
1007059156 6:38921369-38921391 GCCAACCTGGCCAAGCAGGAAGG + Exonic
1007374290 6:41445719-41445741 CCCAACCTCCTCAACCCCCATGG + Intergenic
1007662126 6:43493213-43493235 CACAACCTTCTGAATCAGGAAGG - Intronic
1008234445 6:49026895-49026917 CCCACCCTCCTCCAGTTGGATGG + Intergenic
1012360792 6:98376974-98376996 CCCAACCTCCTCACTCAAGTAGG + Intergenic
1013633586 6:112008308-112008330 CCTGACCTCCTGGAGCAGGATGG + Intergenic
1013838325 6:114359419-114359441 CCCACCCTGCTGAAGCAGGTGGG + Intergenic
1015506701 6:133995658-133995680 CCCAGCCTCCTTCAGCTGGATGG + Intronic
1017182297 6:151564938-151564960 CCCCACCTTCTCCAGCAGCAGGG - Intronic
1018163074 6:161066737-161066759 ACCAAGCTCCTCCAGCAGGAAGG + Intronic
1018440402 6:163807195-163807217 TCCACCCTCGTCAGGCAGGATGG - Intergenic
1019771539 7:2886589-2886611 CCCAGCCTGCTGGAGCAGGAAGG - Intergenic
1019815477 7:3196998-3197020 CCCAACTTCCTGATCCAGGATGG + Intergenic
1020328178 7:6992508-6992530 CCCAAATTCCTCAAGTAGAAAGG - Intergenic
1022344287 7:29499311-29499333 CCCAAACTGCCCAAGGAGGAAGG + Intronic
1022565069 7:31391441-31391463 CCCAAAGGCCTCAAGGAGGAAGG + Intergenic
1027329797 7:77079800-77079822 CCCCACCTCCTGAAGCAGGAAGG - Intergenic
1029027598 7:97433627-97433649 CCTTATCTCCTCAAACAGGAAGG + Intergenic
1029622975 7:101701553-101701575 GCCAGCCTCCCCAATCAGGAAGG + Intergenic
1029785965 7:102791539-102791561 CCCCACCTCCTGAACCAGGAAGG + Intronic
1032127674 7:129206450-129206472 CCCATCCACCTGCAGCAGGAAGG - Exonic
1032508698 7:132455053-132455075 CCCAACCTCCTCAGTCAGGGTGG - Intronic
1035053873 7:156020744-156020766 CCAAACCCCCTCCACCAGGAGGG + Intergenic
1035242019 7:157538389-157538411 ACCAAGCTCCTCTAGCTGGAGGG + Intergenic
1036228746 8:6982111-6982133 ACCAGCCTCCTCAAGCAGCACGG - Intergenic
1036231198 8:7001221-7001243 ACCAGCCTCCTCAAGCAGCACGG - Intronic
1036233648 8:7020320-7020342 ACCAGCCTCCTCAAGCAGCACGG - Intergenic
1036815153 8:11896828-11896850 ACCAACTTCCACAAGCAGAAAGG - Intergenic
1037323354 8:17664663-17664685 CCCCACCCCCAGAAGCAGGAGGG + Intronic
1037901525 8:22692044-22692066 CCCAGCCTCCTCGGGCATGAAGG + Intronic
1038639949 8:29315744-29315766 TCCAATCTCCTCAAGGCGGATGG - Intergenic
1041275938 8:56157422-56157444 CCCAACCCCCTGAGGGAGGAGGG + Intergenic
1042859412 8:73297463-73297485 CCCAACCTTCTCATTAAGGAGGG - Intronic
1046277614 8:111984227-111984249 CTCATCCTCCCCAAGCAGCAGGG - Intergenic
1046410046 8:113830294-113830316 ACCAGCCTCCTCAAGCAAGAGGG + Intergenic
1049336536 8:142089648-142089670 CCCAACCTCCACCAGCAACACGG + Intergenic
1049566759 8:143344338-143344360 TCCTTCTTCCTCAAGCAGGAGGG - Intronic
1051658914 9:19408456-19408478 CCCAACCTGCTCCAGCAGCCGGG + Intergenic
1055369437 9:75581306-75581328 CCCCTCCTCCCCCAGCAGGAAGG + Intergenic
1055868302 9:80842471-80842493 ACCACTCTCCTCTAGCAGGATGG + Intergenic
1061053323 9:128208680-128208702 GCAAGCCTCCCCAAGCAGGATGG - Intronic
1062575279 9:137203891-137203913 ACCCACCTCCTAGAGCAGGAAGG + Intronic
1187441112 X:19321075-19321097 CTGACCTTCCTCAAGCAGGAAGG - Intergenic
1192559186 X:72114427-72114449 TCCAAACTCCTCTGGCAGGAAGG - Intergenic
1194507291 X:94748222-94748244 CCCAACCTCCACCATCAGGTTGG + Intergenic
1196995392 X:121377215-121377237 CCCAACTTCCTCAACCACTATGG - Intergenic
1200940856 Y:8780165-8780187 GACAACCTCCTTAACCAGGATGG + Intergenic