ID: 944956493

View in Genome Browser
Species Human (GRCh38)
Location 2:204817454-204817476
Sequence CAGAGTACACAGAAGGGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944956493_944956499 21 Left 944956493 2:204817454-204817476 CCAATACCCTTCTGTGTACTCTG 0: 1
1: 0
2: 2
3: 22
4: 184
Right 944956499 2:204817498-204817520 AGCATTTCAGTGTTCCTTTTGGG 0: 1
1: 1
2: 0
3: 39
4: 318
944956493_944956498 20 Left 944956493 2:204817454-204817476 CCAATACCCTTCTGTGTACTCTG 0: 1
1: 0
2: 2
3: 22
4: 184
Right 944956498 2:204817497-204817519 GAGCATTTCAGTGTTCCTTTTGG 0: 1
1: 0
2: 1
3: 19
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944956493 Original CRISPR CAGAGTACACAGAAGGGTAT TGG (reversed) Intronic
901228207 1:7626841-7626863 AGGAGTAAACAGAAGGGTTTAGG + Intronic
905456351 1:38090706-38090728 CAGTGAACACAGAAGGGTGAAGG + Intergenic
906703965 1:47881071-47881093 CAGACTACACCGCAGGGCATGGG + Intronic
906910921 1:49949410-49949432 CAGAGTAAACAGAATGCTGTGGG + Intronic
909856045 1:80533187-80533209 CAAAGTACACACTAGGTTATAGG + Intergenic
910293393 1:85620202-85620224 CAGAGTATACAGAAAGTAATTGG - Intergenic
910866846 1:91796626-91796648 CAGAGGACACAGGAGGAAATGGG + Intronic
914335323 1:146709749-146709771 TAGAGTATACAGGAGGGTGTTGG - Intergenic
916763197 1:167835280-167835302 CAGAGGACACAGAAGGGTAAAGG - Intronic
917090139 1:171344673-171344695 CAGATTACACAACAGGGAATGGG - Intergenic
917560361 1:176146233-176146255 CAGATTAAACAAAAGGGTGTTGG - Intronic
917957093 1:180110435-180110457 CACAGTCCACAGGAGAGTATCGG - Intronic
918249941 1:182694004-182694026 CACAGTACCCAGTAGGGTACTGG - Intergenic
919488998 1:198181544-198181566 CACATTACACAGAAAGTTATTGG + Intronic
920972845 1:210757328-210757350 AGGAGTACACAGAAGGGACTGGG + Intronic
921190491 1:212703996-212704018 CAGAATACAAAGCAGGGAATAGG + Intergenic
922490759 1:226014599-226014621 CAGAGCACACAGGAAGGAATGGG - Intergenic
922719079 1:227891172-227891194 CAGACTGCACAGGAGGGGATGGG + Intergenic
1064071567 10:12233440-12233462 CACAAAACACAGAAGGGGATAGG - Intronic
1065415783 10:25484078-25484100 CAGATTACATAGAATGTTATAGG - Intronic
1065713927 10:28545555-28545577 GAGAGTACACAGAAGGGAAGAGG + Intronic
1068064776 10:52115761-52115783 CTGGGTATACAGAAGGGTAAAGG - Intronic
1070598729 10:77851024-77851046 CAAAGCACACAGCAGGGTGTAGG + Intronic
1070992460 10:80744483-80744505 AAGAGAACACAGAAGGGAAATGG + Intergenic
1072223598 10:93348155-93348177 CAGAGCACAGGGAAGAGTATAGG - Intronic
1073962248 10:108945823-108945845 CACAGTTCACAGAAGGGTTTGGG + Intergenic
1075369343 10:121921772-121921794 CACAGTTCACAGAAGGGGGTGGG - Intronic
1075732866 10:124646693-124646715 CAGAGTTCACATAAGGGGGTTGG - Intronic
1077704333 11:4469748-4469770 CTGAGTTTACAGAAGGGAATAGG + Intergenic
1080577036 11:33609412-33609434 CAGAGGAACCAAAAGGGTATAGG + Intronic
1080682082 11:34486524-34486546 CAGAGTGAATAGAAGGGCATGGG + Intronic
1081543951 11:44056492-44056514 CAGATAACACAGCAGGGTGTAGG + Intronic
1083971390 11:66078356-66078378 CAGACTACAAAGAAGGGAACAGG - Intronic
1084933230 11:72573480-72573502 CAGAGGTCAGAGAAGGATATGGG - Intergenic
1086541782 11:87921352-87921374 CACAGTACACTGTAGTGTATTGG - Intergenic
1087897023 11:103597520-103597542 CAGAGTAGACAGAAGGAAACAGG - Intergenic
1089849216 11:121482015-121482037 CATAGTACACAGATGCCTATAGG + Intronic
1090754791 11:129780316-129780338 CAGAGGAGACAGAAAGGGATGGG - Intergenic
1090933361 11:131319757-131319779 CACATTAGACTGAAGGGTATGGG + Intergenic
1091660284 12:2378094-2378116 TAAAGTCCAAAGAAGGGTATGGG - Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097236562 12:57544292-57544314 CAAAGTATACAGGAGGGTGTAGG - Intronic
1098043918 12:66380394-66380416 CAGAGAACTCAGAAGGGCAACGG + Intronic
1098150484 12:67541385-67541407 CAGAATAAGCAGAAGGGTATTGG + Intergenic
1098342841 12:69470066-69470088 TAGAGTACACTGAAGGGAGTCGG + Intergenic
1101186318 12:102284338-102284360 CAGATTAGACAGATGGGTAGGGG + Intergenic
1106646782 13:31643556-31643578 CAGAGAAAACAGAAGTATATAGG + Intergenic
1107879793 13:44822932-44822954 CGGAGTTCACAGAAGGCTTTCGG - Intergenic
1107926527 13:45268201-45268223 CAGAGTAGACAAAATGGTAAAGG - Intronic
1109288243 13:60437803-60437825 AACAGTACACAAAAGGATATGGG - Intronic
1110605378 13:77426294-77426316 CAGAGGACACAGAAATGTTTAGG + Intergenic
1111080660 13:83302428-83302450 CAGAAGAGACAGAAGGGTAAAGG - Intergenic
1111727082 13:92025344-92025366 CTGTGTACACAGAAGTGTTTTGG - Intronic
1111935277 13:94550875-94550897 CAGAGTTCAGAGAAGGGTTTGGG + Intergenic
1114512417 14:23273704-23273726 CAGAGTACCAGAAAGGGTATGGG - Exonic
1115733939 14:36303012-36303034 CACAGTACACTGTAGAGTATCGG - Intronic
1116388256 14:44359458-44359480 CACAGTTCACAGTAGGGTCTCGG + Intergenic
1118786346 14:69048666-69048688 CACAGTACACTGCAGAGTATTGG - Intergenic
1119458112 14:74774221-74774243 CACAGTACACAGTAGAGTATTGG + Intronic
1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG + Intronic
1121274058 14:92656058-92656080 AGGAGGACACAGAAGGGCATGGG + Intronic
1122352953 14:101107848-101107870 CACAGTACCCAGTAGAGTATTGG - Intergenic
1122499989 14:102191083-102191105 CAGAGCACACAGAAGTATTTGGG - Intronic
1123960575 15:25395413-25395435 CAGAGTAAACAGAAGTATAATGG + Intronic
1125190514 15:36987099-36987121 GAGAGTACACACAAGGAAATGGG + Intronic
1127057791 15:55150294-55150316 CAGGGGAAACAGAAGTGTATAGG - Intergenic
1127286970 15:57541027-57541049 CACAGTACCCTGAAGGGTAGAGG + Intronic
1128775239 15:70315509-70315531 AAGAGGACACAGAAGGATGTAGG - Intergenic
1130079640 15:80721329-80721351 CAGAGGACTCAGACAGGTATGGG - Intronic
1131378330 15:91943749-91943771 CAGAGGACACAGAATGGCCTGGG + Intronic
1131694256 15:94857843-94857865 CAGAGTTCAAAGAAGAATATTGG - Intergenic
1132023210 15:98382653-98382675 CAGAGCACACAGAATGGACTGGG + Intergenic
1139998300 16:71001479-71001501 TAGAGTATACAGGAGGGTGTTGG + Intronic
1141921483 16:87138560-87138582 CAGAGGAGACAGAAGGGCAAAGG + Intronic
1143806519 17:9432803-9432825 GAAAGTACACAGAAGGTTAGAGG - Intronic
1147377719 17:40032807-40032829 CAGAGTCCACAGAAGGGTGACGG - Intronic
1148138463 17:45311059-45311081 CAGAGTACAGTGAAGAGTCTGGG + Intronic
1148680994 17:49473376-49473398 CAATGTACACACAAGGGGATGGG + Intronic
1149820987 17:59777421-59777443 AAGAGGACTCAGAAGGGCATCGG - Intronic
1150127180 17:62644950-62644972 CAGTGTTCACAGAAGGGGAGGGG + Intronic
1163062607 19:14771318-14771340 CAGAGTACACAGAGTGGGAAGGG - Intronic
1164874592 19:31674819-31674841 CAGATTACACAGAATTTTATCGG - Intergenic
1164927353 19:32140635-32140657 CAGAGTAAACAGCAGGTTCTGGG + Intergenic
1166663500 19:44662754-44662776 CAGACCACACAGAAGGGTGTGGG + Exonic
1166712145 19:44944596-44944618 CAGGGGACACATAAGGGTAAAGG + Intronic
1167228609 19:48267160-48267182 CAGAGAAAATAGAAGGGAATTGG + Intronic
1167357097 19:49010815-49010837 CAGAGAACACAGGAGGGGAGAGG - Intronic
931562836 2:63581533-63581555 TAGAGTACACAGAAAAGTCTTGG + Intronic
931936513 2:67203220-67203242 CAGAGCAGAGAGAAGGGTTTTGG + Intergenic
932196783 2:69790740-69790762 CAGAGAAAACAGAAAGGCATCGG - Intronic
932361469 2:71111471-71111493 AAGAGTACTCAGAAGGGCTTTGG - Intronic
933987369 2:87603133-87603155 CAAAGTAAACAGAAATGTATTGG + Intergenic
935091087 2:99895672-99895694 CAGAGCACACAGCAGGGACTCGG + Intronic
935268388 2:101413629-101413651 CAGAGGACACAGAGGGCTCTTGG + Intronic
936306470 2:111347675-111347697 CAAAGTAAACAGAAATGTATTGG - Intergenic
937061072 2:118980861-118980883 CAGAGGACTCAGAAGGGGACAGG + Intronic
937856119 2:126673039-126673061 CCTAATACCCAGAAGGGTATTGG + Intronic
937911791 2:127079140-127079162 CAGAGCACACAGCAGTGTTTGGG - Intronic
938996063 2:136679598-136679620 CAGAGTAAACAGAAGACTTTTGG + Intergenic
939846620 2:147254679-147254701 AAGAGTAAAAAGAAGGGTTTGGG + Intergenic
940917994 2:159278843-159278865 AAGAGTAGACAGAAAGGTTTTGG - Intronic
942284061 2:174396006-174396028 CAGAGTCCACAGAAAGTAATGGG - Intronic
943056121 2:182982578-182982600 CATAGTACACTGAAGAGTATAGG - Intronic
943924347 2:193753059-193753081 CCTAGTGCACAGAAGAGTATAGG + Intergenic
944956493 2:204817454-204817476 CAGAGTACACAGAAGGGTATTGG - Intronic
1169678895 20:8187196-8187218 CAAAGTACACAGAAGGCAATTGG - Intronic
1170394438 20:15910918-15910940 CAGAGCACAGAGATGGGTAGAGG - Intronic
1170919318 20:20661652-20661674 CAGAATACACAGATGTGTACTGG + Intronic
1171310322 20:24140180-24140202 CAGAGTACAGTGAAGGGTCTGGG + Intergenic
1172025318 20:31944409-31944431 CAAAGTTTACAAAAGGGTATAGG + Exonic
1173016610 20:39231599-39231621 CTGAGTCCACAGAAGGGAAAAGG - Intergenic
1175533719 20:59692552-59692574 CAGAGTACAGAGAATGGTATTGG - Intronic
1177382553 21:20364406-20364428 CAGAGGACACAGGAGTGCATGGG + Intergenic
1178654671 21:34451680-34451702 CAGAGTTCAGAGATGGGTAGAGG - Intergenic
1179147120 21:38777938-38777960 CAGGGTTCTCAGAAGTGTATTGG - Intergenic
1179258467 21:39737974-39737996 GAGAGTACGCAGAAGGGTGATGG + Intergenic
1182575680 22:31271342-31271364 CAGAGGACAGAGAAGGGCATTGG - Intronic
1183339669 22:37273260-37273282 CAGAGCCCACAGAAGTGTTTCGG + Intergenic
950576838 3:13837168-13837190 AAGTGTTCACAGAAGGGTTTTGG - Intronic
954366736 3:50150449-50150471 GGGAGAACACAGAAGGGTCTGGG + Intergenic
955592823 3:60556298-60556320 CAGAGGAGACAGAAAGGTAAAGG + Intronic
957578056 3:82034482-82034504 CAGAGTATAAAGCAGGGTAAGGG + Intergenic
962957436 3:140279148-140279170 CAGAGTACATAGAAGCCAATGGG - Intronic
963073315 3:141323019-141323041 CAGACAAAACAGAAGGGTACAGG - Intergenic
963710933 3:148746685-148746707 AACAGTAGACAGAATGGTATGGG + Intergenic
964995545 3:162874672-162874694 CATAGTTCACAGTAGGGTTTGGG - Intergenic
966012492 3:175098155-175098177 CAGCAGACACAGAAGGGTATAGG - Intronic
967642556 3:191883309-191883331 CACAGTACACTGTAGGGTATTGG + Intergenic
968476515 4:812521-812543 CAGAGTAATAAAAAGGGTATGGG + Intronic
969955450 4:10885487-10885509 CATAGTACAGAGAAGGGAATTGG + Intergenic
970250203 4:14106496-14106518 TAGAGTGCACAGTAGGGCATGGG + Intergenic
971317249 4:25577774-25577796 CAGAGTTCACAGAATTGTAAGGG - Intergenic
971495820 4:27264147-27264169 TAGATTAAACAGAAGGTTATGGG + Intergenic
973821218 4:54663266-54663288 CAGAGCACACAGCAGGGAAGAGG - Intronic
976231920 4:82853082-82853104 AAGAGGCCACAGAAGGGTACTGG + Intronic
976706912 4:88028623-88028645 CACAGTACACTGTAGAGTATTGG + Intronic
978467199 4:109021093-109021115 CACAGTACACAGTAGAGTATTGG - Intronic
978521733 4:109622914-109622936 CACAATACACAGCAGAGTATTGG - Intronic
978921469 4:114188202-114188224 TAGAGTACACACAAGAGTTTGGG - Intergenic
979772821 4:124550633-124550655 AAGAGTACAAAGAAGGGTCTTGG - Intergenic
981612424 4:146609142-146609164 CAGAATACAGTGAAGGGTCTGGG - Intergenic
981616950 4:146652398-146652420 CAGAGTGTACAAAAGGGTTTGGG - Intergenic
982087286 4:151848585-151848607 CAGGCTACAGAGAAGGGGATTGG + Intergenic
983184407 4:164684984-164685006 CAGGGTACAGAGATGGGTAAGGG + Intergenic
984802470 4:183727733-183727755 CAGAGTACGCAGAAGTGTAGCGG + Intergenic
985614983 5:914867-914889 CAGAGTCCACAGAAAGGAAATGG + Intronic
988009388 5:25463207-25463229 CAGAGATCACATAAGGGTGTAGG + Intergenic
988013069 5:25515631-25515653 CAGAGTTCACAACAGGGTTTGGG + Intergenic
988586406 5:32511313-32511335 AAAAATACACAGAAGGATATGGG + Intergenic
991307466 5:65194390-65194412 CACAGTACACTGTAGAGTATTGG - Intronic
992654198 5:78892100-78892122 CAAAGTACACAGAACAGAATAGG + Intronic
993864513 5:93176257-93176279 CAGAGTAGACAGAAGGGTTGGGG - Intergenic
994167236 5:96620500-96620522 CAGAGTACACTGCAGAGTACTGG - Intronic
994392483 5:99203869-99203891 CAGAATATTCAGAAGGGTAGAGG - Intergenic
994888047 5:105592012-105592034 CAGAGGACAAAGAAGGGTACAGG - Intergenic
996192910 5:120567434-120567456 CAGAGTACACAGAGGGTGGTAGG + Intronic
996804300 5:127437799-127437821 TAGAGTAGACTGAAGGGTACAGG + Intronic
997169929 5:131707172-131707194 CAGATTTCACAGAAGTGTTTCGG - Intronic
1004681464 6:17899405-17899427 CAGAGGGCACGGAAAGGTATAGG + Intronic
1005292370 6:24392401-24392423 CACAGTACACTGTAGAGTATTGG - Intergenic
1006467033 6:34201988-34202010 CAGAGCACACAGAGAGGTCTAGG + Intergenic
1008524500 6:52394607-52394629 CAGAGGACACCGTAGGGTACTGG - Intronic
1008971103 6:57369168-57369190 CACAGTAAATAGAAGGGTAGTGG - Intronic
1009160064 6:60270987-60271009 CACAGTAAATAGAAGGGTAATGG - Intergenic
1010961163 6:82147604-82147626 CAGAGTACACTGTAGAGTACTGG + Intergenic
1011235717 6:85214015-85214037 TACAGTACACTGATGGGTATTGG - Intergenic
1014544659 6:122719906-122719928 AAAAATACACAGAAGGATATAGG + Intronic
1015242892 6:131045725-131045747 CAGATTTCACAGAAGTTTATAGG - Intronic
1019706024 7:2497756-2497778 CCCAGTACACAGGAGGGTCTGGG + Intergenic
1020049738 7:5073412-5073434 CTGAGTGCAGAGAAGGGTCTGGG - Intergenic
1020827697 7:13052005-13052027 CATAGTACACTGTAGAGTATAGG + Intergenic
1022265980 7:28755290-28755312 TAGTGTAAAGAGAAGGGTATTGG + Intronic
1026101620 7:67388939-67388961 CAATGTACACAGATGGGTAAGGG - Intergenic
1028150207 7:87363556-87363578 CAGAGTACACAGGAGGGAGCTGG + Intronic
1028438992 7:90837539-90837561 CAGATTACACAGAAAGAGATGGG + Intronic
1028515087 7:91669538-91669560 CAAAGTACACAGAAGGATCAGGG - Intergenic
1029187384 7:98748952-98748974 CACAGAACACTGTAGGGTATTGG - Intergenic
1030900610 7:115118960-115118982 AAGAGGTCACAGATGGGTATTGG - Intergenic
1031133132 7:117856189-117856211 CAGAGTGCACACAGGTGTATCGG - Intronic
1036579728 8:10062663-10062685 CATAGTGCACTGAAGGGTACAGG + Intronic
1037742758 8:21620511-21620533 CAGAGCACACAGTAGGGTAAGGG + Intergenic
1038339983 8:26677808-26677830 AAGAGTACAGAGAAGCTTATTGG - Intergenic
1040737449 8:50526167-50526189 CAGAGAACACAGAAGAGTTCAGG - Intronic
1043965440 8:86469573-86469595 CAGTCTACTCAGAAGGCTATAGG - Intronic
1047767772 8:128003306-128003328 CAGAGGAGACAGAAGGGGAGGGG - Intergenic
1050480680 9:6084288-6084310 AAGAGAACACAGAAGGGAAATGG + Intergenic
1052020801 9:23523237-23523259 CATAGTTCACAGTAGGGTTTGGG - Intergenic
1054087730 9:60762308-60762330 CACAGTACACAGCTGAGTATTGG - Intergenic
1054557124 9:66668064-66668086 CACAGTACACAGCTGAGTATTGG - Intergenic
1054836822 9:69684183-69684205 CAGAGTATACAGAAGCCTAAGGG - Intergenic
1055096824 9:72422486-72422508 TAGAGGACTCAGAAGTGTATTGG - Intergenic
1056348801 9:85726638-85726660 CAGACAACACAAAATGGTATAGG - Intronic
1060044636 9:120330115-120330137 CAGTCTACTCAGAAGGGTATAGG + Intergenic
1061664618 9:132153267-132153289 CAGAGTGCTCAGAGGGGTGTAGG - Intergenic
1186002531 X:5029089-5029111 CAAAGAACATAGAAGGGTATAGG + Intergenic
1186434214 X:9529204-9529226 CAGAGGACACAGAAAGCAATGGG - Intronic
1186683476 X:11900269-11900291 GAGTGAACACAGAAGGGCATTGG + Intergenic
1187144693 X:16626767-16626789 CAGAGGTCACAGAAGGGGAAGGG - Intronic
1187923607 X:24230029-24230051 TAGAGTACGCAGAAGAGTCTTGG - Intergenic
1188779950 X:34269590-34269612 CAGAGTAAAGAGAAAGGTAAAGG + Intergenic
1189402681 X:40686981-40687003 AAGAGTATACAGAAGGAGATGGG - Intronic
1189630767 X:42950464-42950486 CAGGGTAGAGAGAAAGGTATGGG + Intergenic
1190912801 X:54788115-54788137 AAGAGAACACAGGAGAGTATAGG + Intronic
1190918153 X:54825261-54825283 AAGAGAACACAGGAGAGTATAGG - Intergenic
1197384151 X:125782764-125782786 CAGAGGAAACAGAAAGGGATGGG - Intergenic
1200398957 X:156007615-156007637 CAGAGACCACAGAAGGACATGGG + Intronic
1202015263 Y:20399332-20399354 CAGAGTTGACAGAAAGGAATGGG - Intergenic