ID: 944957238

View in Genome Browser
Species Human (GRCh38)
Location 2:204825997-204826019
Sequence CTTTGGAGACTCCCGTGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944957238_944957243 22 Left 944957238 2:204825997-204826019 CCACTGCACGGGAGTCTCCAAAG 0: 1
1: 0
2: 0
3: 7
4: 101
Right 944957243 2:204826042-204826064 GCTTTTTCTGAGGAAATTCCAGG 0: 1
1: 0
2: 0
3: 20
4: 472
944957238_944957242 12 Left 944957238 2:204825997-204826019 CCACTGCACGGGAGTCTCCAAAG 0: 1
1: 0
2: 0
3: 7
4: 101
Right 944957242 2:204826032-204826054 CACTTTTATTGCTTTTTCTGAGG 0: 1
1: 1
2: 4
3: 52
4: 674

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944957238 Original CRISPR CTTTGGAGACTCCCGTGCAG TGG (reversed) Intronic
905629105 1:39509017-39509039 CTGTGGGGACGCCCGTGCTGTGG - Intronic
911955972 1:104235638-104235660 CTTTGCACACTCCAGTGGAGAGG + Intergenic
917889833 1:179425285-179425307 CTTTGGAAACTCCCCTACATAGG - Intronic
918108561 1:181434828-181434850 CACTGGAGGCTTCCGTGCAGCGG + Intronic
919381785 1:196869442-196869464 CCTTGGGCACTCCCTTGCAGAGG - Intronic
919537120 1:198801170-198801192 CTTTCCAGACTGCAGTGCAGGGG - Intergenic
919787620 1:201269827-201269849 GGTGGGAGACTCCGGTGCAGGGG + Intergenic
922167426 1:223127851-223127873 CTCTGCAGACTCCAGAGCAGTGG + Intronic
1069902150 10:71712579-71712601 CTTTGCACACTCCCGGGCACCGG - Exonic
1070663004 10:78321172-78321194 ATTTGCAGACTCACGTGTAGTGG + Intergenic
1070765547 10:79054090-79054112 CCTTGGGGGCTCCTGTGCAGGGG + Intergenic
1073513105 10:104054743-104054765 TTTTGGAGATTCCTGTGCACAGG + Intronic
1077432514 11:2522821-2522843 CCTGGGAAAGTCCCGTGCAGTGG - Intronic
1080156784 11:29120411-29120433 CTTTGGCGGAGCCCGTGCAGTGG + Intergenic
1084457385 11:69275923-69275945 CTTTGGAGCTTCCTGTGCAGTGG + Intergenic
1085026926 11:73241806-73241828 GTTTGGAGAGTTCTGTGCAGGGG - Intergenic
1086066771 11:82753951-82753973 CATTGGAGATTTCCGAGCAGAGG + Intergenic
1090679800 11:129042839-129042861 CTCTGGAGACTCTCATGAAGAGG + Intronic
1090713887 11:129412989-129413011 GTTTGGAAACTTACGTGCAGTGG + Intronic
1095422548 12:42040435-42040457 CTTTGGAGACACCCATCCAAAGG - Intergenic
1095833218 12:46609712-46609734 CTTTGGAGCCTCCCATTCACTGG + Intergenic
1096571030 12:52523300-52523322 CCTTGGAGACTGCCCTGCTGGGG - Intergenic
1097633572 12:62094316-62094338 CTTTGGAGACTCAGGTGGGGAGG + Intronic
1102126809 12:110489462-110489484 TTTTGGAGACTAGAGTGCAGTGG - Intronic
1103981945 12:124742405-124742427 CTTTGCAGACTCCCGAGGGGCGG + Intergenic
1113768636 13:112895239-112895261 CCCTGGAGACTCCCGCCCAGGGG + Intronic
1114265279 14:21069938-21069960 CTTTGGAGCATCCCTTGCCGAGG + Intronic
1122202458 14:100130813-100130835 CTCCGGAGACGCCCGTGCTGCGG - Intronic
1127865802 15:63031818-63031840 CTTTGGAGTCACCCGGGCAAGGG - Intergenic
1128978220 15:72168413-72168435 CTTTGGAGGCTCCAGAGCAGAGG + Intronic
1129902192 15:79159588-79159610 CTTTGCAGACTCCAGAGCTGTGG + Intergenic
1132350747 15:101138372-101138394 CTGGGGCTACTCCCGTGCAGTGG - Intergenic
1132907564 16:2290758-2290780 CTCTGGGGACACCTGTGCAGGGG - Intronic
1133050077 16:3112615-3112637 CTGTGGAGACTCCCTTCCCGGGG + Exonic
1134421507 16:14095310-14095332 CTTGGGAGACTCCCTTGTAGAGG + Intronic
1138266900 16:55666050-55666072 TTTTGGAGACTCCCAGGCACTGG + Intronic
1141425306 16:83940925-83940947 CTGTGGAAACCCCGGTGCAGTGG + Intronic
1143960169 17:10710506-10710528 CTTTGCAGACTGCCCTGCATAGG + Intronic
1147778339 17:42920213-42920235 CTTTGGAGGCTTTGGTGCAGGGG - Intergenic
1148197685 17:45726458-45726480 CTCTGGATACTCCAGTGTAGAGG + Intergenic
1148768472 17:50053282-50053304 CTCTGGACACTCCCCTGGAGTGG + Intergenic
1151466213 17:74287142-74287164 CTTTGGAGGCGCCCATGCATGGG - Intronic
1158734126 18:60060750-60060772 CTTTGGAGATTCCAGCCCAGGGG - Intergenic
1160526945 18:79543909-79543931 CTTGGGAGCCTCCCGTGGGGAGG - Intergenic
1161510677 19:4669576-4669598 CTTTTTAGACTTGCGTGCAGTGG - Intronic
1165350457 19:35272427-35272449 CTCAGGAGAGTCCCGGGCAGAGG + Intronic
925171737 2:1754348-1754370 CTTTGAAGGCTCCCATGCACTGG + Intergenic
925815154 2:7740081-7740103 CCTTGGAGGCTGCCCTGCAGAGG + Intergenic
932396356 2:71451545-71451567 CTTTGGAGAATACAGTGCAAGGG - Intergenic
934486504 2:94717909-94717931 TTTTGGAGACTGGAGTGCAGTGG - Intergenic
934711581 2:96518458-96518480 CTCTGGACACTCCCATGTAGAGG - Intergenic
935345551 2:102104442-102104464 CTTTAGAGGTTACCGTGCAGTGG + Intronic
935591120 2:104845874-104845896 CTTTGGAGTCTCCAGCGCTGAGG - Intergenic
937165539 2:119812365-119812387 CTTTGGAGACTACCAGGCATTGG + Intronic
937624481 2:124027082-124027104 CTTTGGATACTCCCTTAGAGAGG - Intronic
939656357 2:144830988-144831010 ATTAGGAGGCTCCCGTGCAATGG + Intergenic
942486490 2:176445362-176445384 CATTGTAGAGTACCGTGCAGGGG + Intergenic
944286608 2:197957340-197957362 CTTTGGATAGTACCTTGCAGAGG + Intronic
944957238 2:204825997-204826019 CTTTGGAGACTCCCGTGCAGTGG - Intronic
948242816 2:236452502-236452524 CTTTGGAGGCTTCTGTGCAGTGG - Intronic
1168855486 20:1004750-1004772 CTTTGGAGACTCCAGTACTGGGG - Intergenic
1168899118 20:1345262-1345284 CTGTGGAGGCTCACGTGGAGAGG + Intronic
1170398145 20:15950409-15950431 TTGTGGAGACTCCTGGGCAGAGG - Intronic
1170428824 20:16259420-16259442 CCTGGCTGACTCCCGTGCAGGGG - Intergenic
1176293880 21:5060312-5060334 GTCTGGGGACTCCCGTGCTGCGG + Intergenic
1177530042 21:22346684-22346706 CCTTGCAGACTCCACTGCAGAGG + Intergenic
1179863379 21:44203336-44203358 GTCTGGGGACTCCCGTGCTGCGG - Intergenic
949357761 3:3199946-3199968 CTTTGGAGACTCGGGAGGAGAGG - Intergenic
953478240 3:43224798-43224820 GTTTGGGGACTCCCCTGCAGGGG + Intergenic
953590260 3:44245125-44245147 CTTTGGAGTCTCCAATGAAGGGG + Exonic
953851453 3:46468396-46468418 CTGTGGAAACTGCCATGCAGTGG + Intronic
962313067 3:134339499-134339521 CTTGGGACACTCACCTGCAGGGG - Intergenic
968263550 3:197344216-197344238 TTTTGGAAACACCCGAGCAGGGG - Intergenic
969716183 4:8869382-8869404 GTCTGGAGCCTCCCGTGCAAAGG + Intronic
983382761 4:167018598-167018620 CTTTGGAGATTCTCCTTCAGAGG + Intronic
986413997 5:7510350-7510372 TATTGGAAACTCCCCTGCAGTGG + Intronic
997310654 5:132878167-132878189 CTGTGGAAACTCCCCTGAAGGGG + Exonic
1001750158 5:174123106-174123128 CTTTGGAGACTCAGGAGGAGCGG - Intronic
1001987435 5:176086605-176086627 CTTGGGGGACTCCAGGGCAGTGG - Intronic
1002229435 5:177751537-177751559 CTTGGGGGACTCCAGGGCAGTGG + Intronic
1002265910 5:178032236-178032258 CTTGGGGGACTCCAGGGCAGTGG - Intronic
1003893086 6:10580739-10580761 CTTTGTAAACTCACCTGCAGTGG + Intronic
1011286431 6:85729354-85729376 CTTTGGAGACTCAGGTGAAAGGG - Intergenic
1012724775 6:102796763-102796785 CTTTGGGGACTCCAGTGAAAAGG + Intergenic
1019323995 7:429082-429104 GTTTCGCGACGCCCGTGCAGGGG - Intergenic
1019532040 7:1508438-1508460 CTTTGGAGAATTCTGAGCAGGGG - Intergenic
1020135793 7:5587178-5587200 CTCTGGAGCCTCCCCTGCACAGG + Intergenic
1021954784 7:25813425-25813447 CTCTGGATAATCTCGTGCAGAGG - Intergenic
1025712983 7:63928523-63928545 CTTCGGAGACTCACAAGCAGAGG + Intergenic
1026529899 7:71187881-71187903 CTTTGGAGACTCAGGTGGAAAGG - Intronic
1028823137 7:95235976-95235998 CTTTGGAGACTCAAGTGAAAAGG + Intronic
1047515221 8:125548102-125548124 CTGTGGAGACTGGAGTGCAGTGG + Intergenic
1049797113 8:144501857-144501879 CGGTGGAGGCTCCCGTGGAGAGG + Exonic
1052824644 9:33166469-33166491 CCTTGGAGACTTCCCTGCTGTGG - Intronic
1053414759 9:37940167-37940189 CTTTGGTGATTCTGGTGCAGTGG - Intronic
1053671294 9:40366416-40366438 TTTTGGAGACTGGAGTGCAGTGG + Intergenic
1053921104 9:42992790-42992812 TTTTGGAGACTGGAGTGCAGTGG + Intergenic
1054382408 9:64506466-64506488 TTTTGGAGACTGGAGTGCAGTGG + Intergenic
1054513321 9:66009894-66009916 TTTTGGAGACTGGAGTGCAGTGG - Intergenic
1055127083 9:72731248-72731270 CCTTGGAGATTCCAGTGCAATGG + Intronic
1056472303 9:86917872-86917894 CTCTGGAGACTCTGGTTCAGTGG + Intergenic
1058654774 9:107210230-107210252 CTTTGGAGACTCACGGGAAAAGG + Intergenic
1186413109 X:9360944-9360966 CTTTGGAGACTCCACAGGAGAGG - Intergenic
1186587236 X:10888403-10888425 CTTTGGAGATTCTGATGCAGTGG - Intergenic
1190446035 X:50525394-50525416 CTTTGAACACTCCTGTGCAGGGG - Intergenic
1193490654 X:82144307-82144329 CTCTGGAGACTCACGTGATGTGG - Intergenic
1195082360 X:101383824-101383846 CTATGGAGATTCATGTGCAGTGG - Intronic
1195740632 X:108061575-108061597 GTTTGGAGACTCCAGGGCACTGG + Intronic
1199108320 X:143899284-143899306 GTTTGGAGACTCAGGTGAAGGGG + Intergenic