ID: 944958660

View in Genome Browser
Species Human (GRCh38)
Location 2:204842772-204842794
Sequence GTACAGCAGGCCTGCGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944958657_944958660 5 Left 944958657 2:204842744-204842766 CCTGACTTCTGATGAAGAAAATC 0: 1
1: 0
2: 0
3: 22
4: 206
Right 944958660 2:204842772-204842794 GTACAGCAGGCCTGCGCTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944958660 Original CRISPR GTACAGCAGGCCTGCGCTGT GGG Intronic
901757337 1:11449336-11449358 GGGCTGCAGGCCTGCGGTGTTGG + Intergenic
903235681 1:21949182-21949204 GTACAGGAGGCCTGAGTTCTTGG + Intergenic
905050508 1:35047011-35047033 TTTCAGCATGCCTCCGCTGTAGG + Intergenic
915938210 1:160101169-160101191 GTCCGTCAGGCCTGGGCTGTGGG - Intergenic
916500273 1:165380977-165380999 GTACAGCAGGATGGTGCTGTGGG + Intergenic
921065862 1:211621496-211621518 GTGCAGCAGGGCTGGGCTGGAGG - Intergenic
923721980 1:236474784-236474806 GTACAGCAGCCCTGTGCTTGTGG + Intronic
1067573540 10:47389018-47389040 GCACTGGAGGCCTGTGCTGTGGG + Intergenic
1073543578 10:104331260-104331282 GTGCAGCATGCCTGGGCTGGAGG - Intronic
1079305426 11:19317251-19317273 GTAAAGCAGGCCTGCGGGGAAGG + Intergenic
1081343695 11:41956920-41956942 GTACTGCTGGCCTGAGCTGGGGG - Intergenic
1083196385 11:61091122-61091144 CTACAGCAGGCCTGGGTTGGGGG + Intergenic
1087926912 11:103929406-103929428 GTACAGCATGCCTTCCCTATAGG + Intronic
1094694926 12:32809041-32809063 GTAGAGCAGGTGTGCTCTGTTGG + Intronic
1094844995 12:34357599-34357621 GTGCACCAGGCATGCGCAGTGGG + Intergenic
1099137049 12:78918466-78918488 GGACAGGAGGGCTGCCCTGTGGG + Intronic
1102056954 12:109903677-109903699 CTACAGCAGACCTATGCTGTAGG + Intronic
1104367648 12:128192539-128192561 TCACAGCCGGCCTGTGCTGTGGG + Intergenic
1107479131 13:40770989-40771011 GTACCGCAGTTCAGCGCTGTTGG - Exonic
1110643842 13:77857674-77857696 GTAGAACAGGCCTGCAGTGTAGG + Intergenic
1111647646 13:91050581-91050603 GTGCATCAAGCCTGGGCTGTTGG + Intergenic
1112040115 13:95538753-95538775 GTACAGCAGGACAACGGTGTTGG - Intronic
1113474680 13:110571972-110571994 CTTCAGCAGGCCTGGGCTGGGGG + Intergenic
1113634583 13:111910730-111910752 CTACAGCAGGCTTGTGTTGTTGG - Intergenic
1113839619 13:113351281-113351303 GTGCAGGAGGCCTGTGCTGGGGG - Intronic
1113851244 13:113419544-113419566 ATACAGCATCGCTGCGCTGTAGG + Intergenic
1115450970 14:33546882-33546904 GTACATTAGGCCTGCCTTGTGGG + Intronic
1115704686 14:35986971-35986993 ATAGAGCAGGCCTGTGCTTTGGG - Intergenic
1116301466 14:43188657-43188679 GTACAGCAGGTATGCTCTATTGG - Intergenic
1119074639 14:71623961-71623983 GCACTGCAGGCCTGAACTGTGGG - Intronic
1121615275 14:95309750-95309772 GCACAGCTGGACTGCCCTGTAGG - Intronic
1121915870 14:97836602-97836624 GGAGAGCAGGCCTCCGCTGCTGG - Intergenic
1128964530 15:72045127-72045149 GTAGAGCAGGGCTACGCTGCAGG + Intronic
1131113263 15:89778249-89778271 GAACCGCAGGCCTGAGCTCTGGG - Exonic
1132803585 16:1765759-1765781 CTCCAGCAAGCCTGCTCTGTTGG - Intronic
1135304164 16:21354611-21354633 CTACAGAAGCCCTGAGCTGTGGG + Intergenic
1136778770 16:32884921-32884943 GGAAAGCAGGCCTGCGCCTTGGG - Intergenic
1136891848 16:33976597-33976619 GGAAAGCAGGCCTGCGCCTTGGG + Intergenic
1140484383 16:75282275-75282297 GTACAGGAGGGCTGGGATGTGGG + Intergenic
1141703179 16:85651613-85651635 GGGCGGCAGGCCTGGGCTGTTGG + Intronic
1142121559 16:88388974-88388996 TTACACCAGCCCTTCGCTGTAGG + Intergenic
1142148093 16:88500919-88500941 GTACAGCGGGCCCTCCCTGTGGG + Intronic
1142177853 16:88653090-88653112 GAGCAGCAGGGCTGCGCTGAGGG - Intronic
1203081185 16_KI270728v1_random:1147010-1147032 GGAAAGCAGGCCTGCGCCTTGGG - Intergenic
1142755350 17:2013467-2013489 GCACAGTTGGCCTGCTCTGTAGG - Intronic
1143126158 17:4641956-4641978 GTACAGCAGGCAGGCGAGGTGGG + Intronic
1143402463 17:6655407-6655429 GTACAGCAGGCAGGCGAGGTAGG - Intergenic
1152873634 17:82772968-82772990 GCGCAGCAGGCCTGCGGTGTTGG + Intronic
1155679946 18:28476292-28476314 GTGGAGCAGGGCTGCTCTGTAGG - Intergenic
1159679270 18:71326923-71326945 TGACAGCAGGCTGGCGCTGTGGG + Intergenic
1159908202 18:74117677-74117699 TCACAGCACGCCTGAGCTGTGGG - Intronic
1161613738 19:5258045-5258067 GTAGCGCACGCCGGCGCTGTTGG + Exonic
1165903026 19:39177637-39177659 GGACAGCAGGGCTGAGCTGTTGG - Intronic
1167411616 19:49347452-49347474 GAACAGCTGGCCAGAGCTGTGGG - Intronic
925629042 2:5869983-5870005 GTCCACCAGGCCTGCGAAGTTGG + Intergenic
927861287 2:26561772-26561794 CTTCAGCAGGCCTGCTCTCTGGG + Intergenic
933544752 2:83695758-83695780 ATACAGAAGGGCTGCGCTCTGGG - Intergenic
944326422 2:198410361-198410383 GTACAGTAGGGCTGAGATGTTGG + Intronic
944958660 2:204842772-204842794 GTACAGCAGGCCTGCGCTGTGGG + Intronic
946042320 2:216792865-216792887 ATTCAGCAGGCCTGCCCTGCTGG - Intergenic
1169575162 20:6951488-6951510 GCACAGCAGGACTTCACTGTGGG - Intergenic
1172108356 20:32529990-32530012 GTACAGATGGCCTGAGATGTCGG - Intronic
1173267300 20:41496100-41496122 GTACAGCAGGACTGTTCTATTGG + Intronic
1175573272 20:60040166-60040188 GTGCAGCAGGCCTGGGGTGGGGG - Intergenic
1175856352 20:62122835-62122857 GCACCGCAGGCCGGGGCTGTTGG - Intronic
1176119116 20:63446137-63446159 GCACAGCAGGGCTGAGCTGAGGG + Intronic
1177829934 21:26126682-26126704 GTACAGGCAGCCTCCGCTGTAGG + Intronic
1179949806 21:44703292-44703314 ATCCAGGAGGCCTGGGCTGTGGG - Intronic
1180692044 22:17725064-17725086 GGACACAAGGCCTGTGCTGTAGG + Intronic
1180787405 22:18554594-18554616 GGGCAGCAGGCCTGGGCTATCGG + Intergenic
1180949450 22:19714587-19714609 GTACCGCAGGCCTGTGCTCATGG - Exonic
1181234335 22:21440711-21440733 GGGCAGCAGGCCTGGGCTATCGG - Intronic
1181244313 22:21494120-21494142 GGGCAGCAGGCCTGGGCTATCGG + Intergenic
1182909823 22:33972828-33972850 GTCCAGCAGGACTGCCATGTAGG + Intergenic
1183205126 22:36413577-36413599 GTACAGCAGCCCTGTACTGCAGG - Intergenic
1184220160 22:43094751-43094773 GGCCAGGAGGCCTGCGCTCTGGG - Intergenic
949346617 3:3082977-3082999 ACACAGCAGGCCTGCTCTGTTGG - Intronic
957288713 3:78249463-78249485 CTCCAGCCGGCCTGTGCTGTGGG + Intergenic
963397196 3:144749904-144749926 GAGCAGCAGGCCGGCCCTGTCGG + Intergenic
967884244 3:194322438-194322460 CCACAGCAGACCTGCGCAGTGGG + Intergenic
978888217 4:113791234-113791256 GTTCAGCAGCCCTATGCTGTAGG + Intergenic
979233817 4:118376554-118376576 ATACAGCAGGCATGCCTTGTTGG + Intergenic
984119113 4:175720509-175720531 GTACAGCACTCCTGTACTGTGGG + Intronic
988616505 5:32780227-32780249 GAGCAGCAGGCCTGCTTTGTGGG - Intronic
988732850 5:33990517-33990539 GTAAAGCAGCCCTGCTCTTTGGG - Intronic
995674751 5:114651100-114651122 GTAAACCAGGCCTGCAATGTTGG - Intergenic
995991725 5:118247665-118247687 GCACAGCAGGCCTGCCCTGGGGG - Intergenic
1001972596 5:175968310-175968332 GTACAGCGCGCCTGCGCAGAGGG - Intronic
1002244843 5:177875471-177875493 GTACAGCGCGCCTGCGCAGAGGG + Intergenic
1006401455 6:33820363-33820385 GTTCAGCTGGCGTGCGATGTAGG + Intergenic
1009330211 6:62409921-62409943 GTACAGCAGAGCTGCCTTGTAGG - Intergenic
1014186973 6:118445785-118445807 ATTCAGCAGCCCTGTGCTGTAGG - Intergenic
1016367849 6:143338253-143338275 GTACAACACGCCTTCGTTGTTGG - Intronic
1019053316 6:169201226-169201248 GCACATCTGGTCTGCGCTGTTGG + Intergenic
1019442193 7:1053052-1053074 GCACAGCGGGCCTGCCCAGTGGG + Intronic
1019479524 7:1260118-1260140 GGTCAGCAGGGCTGGGCTGTGGG + Intergenic
1033169582 7:139071772-139071794 GTAGAGCAGGGCTGCCCTGGTGG - Intronic
1034499032 7:151438353-151438375 GTGCAGCAGGTCTGGGCTTTTGG - Intronic
1034562127 7:151887153-151887175 CAACAGCAGGCCTCCTCTGTGGG - Intergenic
1035720301 8:1786194-1786216 GGACAGGAGGCCTGCCCTGGGGG + Exonic
1037898855 8:22675933-22675955 GTACAGCAGGCCAGGGCTGGAGG - Intergenic
1038223395 8:25632030-25632052 GCACAGCAGGGCTGCCCCGTTGG + Intergenic
1039196159 8:35033999-35034021 ATGCAGCAGGCCTGGGCTTTTGG - Intergenic
1040585545 8:48737119-48737141 GGGGAGCAGGCCTGCGCTGTTGG + Intergenic
1041278859 8:56191102-56191124 GTAAAGCAGGCCTGCAGTGATGG - Intronic
1043479379 8:80637894-80637916 GCACAGCAGCCCTGCACTCTTGG + Exonic
1045003454 8:97897737-97897759 GAACAGCAGGTCTGTGCTGAGGG - Intronic
1046520427 8:115318598-115318620 GAGCAGCAGGCCTGCTGTGTTGG - Intergenic
1047752967 8:127896384-127896406 GTCCAGCAGGCCTGGGCTCCAGG + Intergenic
1048783190 8:138023381-138023403 GTACAGCTGGCCTTCCCTGTCGG + Intergenic
1049662183 8:143824441-143824463 GGAGAGCAGGCCTGGGCGGTGGG - Intronic
1053121096 9:35548027-35548049 GGACAGGAGGGCTGCGCTGCAGG - Exonic
1055208608 9:73762716-73762738 GTAGAGCAGCCATGCTCTGTGGG - Intergenic
1056884886 9:90431813-90431835 GGAGAGCTGGCCTGTGCTGTTGG + Intergenic
1060842522 9:126805062-126805084 CTACAACAGGCCTGCGCCGGCGG + Exonic
1061799843 9:133107724-133107746 GCTCAGCAGGCCTGGCCTGTGGG - Intronic
1061986505 9:134133074-134133096 GGCCAGCAGGCCTGGACTGTTGG + Intergenic
1062109472 9:134774070-134774092 GAACAGTGGGCCTGTGCTGTGGG - Intronic
1062286022 9:135772856-135772878 GGGCAGCAGGGCTGAGCTGTCGG - Exonic
1187300595 X:18045567-18045589 TTAGAGCAGGCCTGCACTTTCGG + Intergenic
1191832325 X:65429274-65429296 GTAGAGCAGGCATGCTGTGTTGG + Intronic
1198658027 X:138935946-138935968 GTACAGCCTGGCTGGGCTGTGGG + Intronic
1199172595 X:144748525-144748547 TTACAGCAGGTCTGGGTTGTGGG - Intergenic
1200064384 X:153497564-153497586 GTGCAGAGGGGCTGCGCTGTGGG + Intronic
1200101038 X:153689120-153689142 GGAAAGCAGGCCTGCGCCTTGGG + Intronic
1200126112 X:153815857-153815879 GTGCAGAGGGGCTGCGCTGTGGG - Intronic