ID: 944959886

View in Genome Browser
Species Human (GRCh38)
Location 2:204860042-204860064
Sequence CAGGATTAACTGTAGAAATA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 252}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944959884_944959886 0 Left 944959884 2:204860019-204860041 CCAGCAGTTGCTTTTAATATAAT 0: 1
1: 0
2: 3
3: 29
4: 316
Right 944959886 2:204860042-204860064 CAGGATTAACTGTAGAAATACGG 0: 1
1: 0
2: 0
3: 30
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944959886 Original CRISPR CAGGATTAACTGTAGAAATA CGG Intronic
900597434 1:3488549-3488571 CAGGCTTTTCTGTAGAAAAATGG + Intergenic
902749423 1:18497012-18497034 CCCCATTAACTGGAGAAATAAGG - Intergenic
903506464 1:23839113-23839135 CATTATTAACTGAAGAAAAATGG + Intergenic
904312972 1:29641312-29641334 CATGATTGGCTGTTGAAATAAGG - Intergenic
905472076 1:38200642-38200664 CATTATTAACTGAAGAAAAATGG - Intergenic
908871937 1:68623314-68623336 CAGGGATTACTGTAAAAATATGG + Intergenic
910015856 1:82522298-82522320 CAGTATTAACAGTAGCAGTATGG + Intergenic
910130484 1:83899055-83899077 CAGGGTTAACTTTATAAAAATGG + Intronic
910443397 1:87275917-87275939 CAGCATTTACGGTAGATATAAGG - Intergenic
911468947 1:98291992-98292014 CATTATTAACTGAAGAAAAATGG - Intergenic
912129641 1:106586009-106586031 CATGACCAACTGTAGAAACAAGG - Intergenic
912567880 1:110601471-110601493 CAGGATGAACTGTAGAGAGGAGG + Intronic
913676374 1:121144771-121144793 CATTATTAACTGAAGAAAAATGG - Intergenic
915077683 1:153323588-153323610 TATGTTTAACTGTAGAACTAGGG + Intergenic
917369739 1:174279154-174279176 CAGAAATAACTATAGAAATTAGG - Intronic
917525247 1:175782707-175782729 GAGGATGAAATGTAGAGATAAGG + Intergenic
919070113 1:192744323-192744345 CAGGATTAACAATAGAATTTAGG - Intergenic
920463739 1:206163612-206163634 CATTATTAACTGAAGAAAAATGG - Intergenic
921511534 1:216037093-216037115 CATTATTAACTGAAGAAAAATGG + Intronic
922030858 1:221796344-221796366 CATTATTAACTGGAGAAAAATGG + Intergenic
922625677 1:227039181-227039203 CATTATTAACTGAAGAAAGATGG - Intronic
1064292829 10:14051322-14051344 CAGGATGAACATTAGAGATACGG - Intronic
1065702958 10:28443370-28443392 CAGGATTAAGGGCAGAGATATGG - Intergenic
1066342921 10:34553448-34553470 GAGGAATAACTGTAAAATTAGGG + Intronic
1066516290 10:36164325-36164347 TAGTATTAAATGTAGAAAAATGG + Intergenic
1068507460 10:57920417-57920439 CATAATTAACTGAAGAAAAATGG + Intergenic
1068797126 10:61095587-61095609 CATTATTAACTGCAGAAAAATGG + Intergenic
1070454979 10:76604100-76604122 CAGAATTAAAAGGAGAAATAAGG + Intergenic
1071122843 10:82299415-82299437 CAGGATTTGATGTAGAAATCTGG + Intronic
1074014582 10:109521175-109521197 GAGGATGAAATGTACAAATATGG - Intergenic
1075058173 10:119235705-119235727 TAGGATTTACTTGAGAAATAAGG + Intronic
1077624760 11:3760798-3760820 CAAGATTAACTTTATAAACACGG + Intronic
1078644643 11:13129207-13129229 CAGTATTAACTGAGGAAAAATGG + Intergenic
1079566886 11:21893371-21893393 CATTAATAACTGTAGAACTATGG - Intergenic
1079595016 11:22233545-22233567 CATTATTAACTGAAGAAAAATGG + Intronic
1079732700 11:23955345-23955367 TGGGAAAAACTGTAGAAATAAGG + Intergenic
1085364354 11:75925470-75925492 AAGAATCAACTGTAGGAATAAGG - Intronic
1085400406 11:76232530-76232552 CAGGAAGAACAGTATAAATAAGG + Intergenic
1086644476 11:89202803-89202825 TATAATCAACTGTAGAAATATGG + Intronic
1086864831 11:91968096-91968118 CATTATTAACTGAAGAAAAATGG - Intergenic
1087364719 11:97203658-97203680 CAGAATTCATTGGAGAAATAAGG - Intergenic
1087531292 11:99385787-99385809 CAGGATGCACTGTGGAAAGATGG - Intronic
1087557550 11:99740766-99740788 CATTTTTAACTGAAGAAATATGG + Intronic
1089435806 11:118465270-118465292 CATTATTAACTGAAGAAAAATGG - Intronic
1089668480 11:120035337-120035359 CAGGATTATCTGCAGAAGGAAGG - Intergenic
1091019821 11:132088874-132088896 CATTATTAACTGAAGAAAAATGG + Intronic
1091177195 11:133571576-133571598 CATTATTAACTGAAGAAAAATGG + Intergenic
1091607207 12:1964285-1964307 CAAGATTAACACTAGAAAAATGG - Intronic
1092709742 12:11323134-11323156 CATGATTAACTGAAGAAAAATGG + Intergenic
1092713495 12:11363621-11363643 CATTATTAACTGAAGAAAAATGG + Intronic
1092717206 12:11402828-11402850 CATTATTAACTGAAGAAAAATGG + Intronic
1093412493 12:18883303-18883325 TGGGATTTACTGTAGAAATTAGG - Intergenic
1093627947 12:21372469-21372491 CAGGAATAAATGGAGATATAAGG - Intronic
1095354073 12:41250582-41250604 CATTATTAACTGGAGAAAAATGG + Intronic
1095578289 12:43764568-43764590 CATTATTAACTGAAGAAAAATGG + Intronic
1095850043 12:46792438-46792460 CAGGTTTAACTTTATAAATGAGG + Intronic
1098227902 12:68343532-68343554 TAGGAGTAACTGAAGAAATTTGG + Intergenic
1099615643 12:84931876-84931898 CATTATTAACTGAAGAAAAATGG - Intergenic
1099765560 12:86978654-86978676 CATGATTAACTGAAGGAAAATGG + Intergenic
1100775755 12:97972099-97972121 CAGGATTCAATGTACAAATGAGG - Intergenic
1101972295 12:109323780-109323802 CAGGAGTAACTGAAGCAATAAGG - Intergenic
1102387625 12:112523353-112523375 CATTATTAACAGTAGAAAAATGG - Intergenic
1102990092 12:117309146-117309168 CATGATTAAATGAACAAATATGG - Intronic
1104012105 12:124939150-124939172 CACGATCAACTGTAGACATAGGG - Intergenic
1106184132 13:27393860-27393882 AAGAATAAACTGTAGAAATCTGG - Intergenic
1107144157 13:37039736-37039758 CATTATTAACTGAAGAAAAATGG - Intronic
1107724229 13:43281738-43281760 AAGTTTTCACTGTAGAAATACGG + Intronic
1108285042 13:48898407-48898429 CTGGATTAAGTGTAAAGATAGGG - Intergenic
1109048998 13:57453606-57453628 CAGGATGACCTGAAGAAATATGG - Intergenic
1110654559 13:77981944-77981966 CAGGATTAAATGAAGCAAAAAGG - Intergenic
1113781026 13:112977514-112977536 CAGGATTAATTTTTGAAAAATGG + Intronic
1114679296 14:24471254-24471276 CAGGACTCACTGTAAAAGTATGG - Intergenic
1115750185 14:36481645-36481667 CTGAATTAACCCTAGAAATATGG - Intronic
1116587311 14:46723881-46723903 TAGGATTTACTGGAGAAAAAAGG - Intergenic
1116636376 14:47401474-47401496 CATGATCAACTTTAGAAATGAGG + Intronic
1116877978 14:50133008-50133030 CATTATTAACTGAAGAAAAATGG - Intronic
1117223146 14:53627542-53627564 CATTATTAACTGAAGAAAAATGG - Intergenic
1117386575 14:55220100-55220122 CATTATTAACTGAAGAAAAACGG - Intergenic
1117667451 14:58071604-58071626 GAGGAGTAAATGTAGAAATAAGG + Intronic
1117782768 14:59251707-59251729 CAAGATGAAGTATAGAAATAAGG - Intronic
1118287215 14:64486662-64486684 CAGAAATCAATGTAGAAATATGG - Exonic
1118830723 14:69429107-69429129 CATTATTAACTGAAGAAAAATGG - Intronic
1119596846 14:75942975-75942997 CAGTATTATCTGTAGACATTTGG + Intronic
1125864855 15:43036755-43036777 GAGGATGAAGTGAAGAAATATGG + Intronic
1126972940 15:54138606-54138628 CATGATTAAATATAGAACTATGG - Intronic
1127153558 15:56104767-56104789 CAGGATTTGCTGTGGGAATAGGG - Intronic
1127367185 15:58302110-58302132 TAGGATCAGTTGTAGAAATAAGG - Intronic
1128494725 15:68189319-68189341 CAGGTTTAACAGAAGAGATAAGG + Exonic
1129550549 15:76444250-76444272 CATTATTAACTGAAGAAAAATGG - Intronic
1130127837 15:81108882-81108904 CATTATTAACTGAAGAAAAAAGG + Intronic
1131970660 15:97889527-97889549 CAGGACTAACTTCAGAAATTTGG - Intergenic
1132111068 15:99102773-99102795 CAGGATTTACAGCAGAAATGGGG + Intronic
1133185353 16:4092346-4092368 TAGGAGTCACTGTAGAAATTTGG - Intronic
1137300170 16:47142168-47142190 CAGGAATGACTGTAAAAATTAGG + Intronic
1138614011 16:58150180-58150202 CATTATTAACTGAAGAAAAATGG - Intergenic
1140138686 16:72232637-72232659 TAGTAGTAACTTTAGAAATAAGG + Intergenic
1140575574 16:76164262-76164284 CAGTAATTACTATAGAAATAGGG - Intergenic
1141800775 16:86307549-86307571 CAGGATGAACTCTGGAAATATGG - Intergenic
1143675889 17:8432267-8432289 CATTATTAACTGAAGAAAAATGG + Intronic
1143912128 17:10259474-10259496 CAGGATTAACTGCACAGAAAGGG + Intergenic
1144453627 17:15401292-15401314 CATTATTAACTGAAGAAAAATGG + Intergenic
1146210672 17:30940273-30940295 CACTATTAACTGAAGAAAGATGG + Intronic
1146298650 17:31671391-31671413 CAGGATTCACTGTGGCAATAGGG - Intergenic
1146632646 17:34481961-34481983 CAGGATTCAATGAATAAATATGG - Intergenic
1147239340 17:39080356-39080378 CAGGATTAGCTCCAGAAATGGGG - Intronic
1148753091 17:49957156-49957178 CAGGATTAGCTGGAGAATAAAGG + Intergenic
1149359598 17:55880209-55880231 CATAATTAACTGAAGATATATGG - Intergenic
1152606547 17:81294488-81294510 CACGATAAAATGTAAAAATACGG + Intronic
1153412247 18:4806888-4806910 CATTATTAACTGAAGAAAAAGGG - Intergenic
1154245275 18:12691629-12691651 TAGGGGTAAGTGTAGAAATAGGG - Intronic
1155601713 18:27556323-27556345 CATGATTAACAGAAGAAAAATGG - Intergenic
1155621162 18:27781970-27781992 CAGCAATATCTTTAGAAATAAGG + Intergenic
1157132335 18:45018221-45018243 GAGGATTCACAGTAGAAATAAGG - Intronic
1159157895 18:64607990-64608012 CATGATTAACTGAAGAAAACTGG + Intergenic
1159666816 18:71171413-71171435 CAGGATTGCCTGGAGAACTAGGG + Intergenic
1163914025 19:20223461-20223483 TAGGATTAAATTTAGCAATATGG - Intergenic
1164386656 19:27777014-27777036 CAGGAATGAGTGTAGAAAAAGGG - Intergenic
926591766 2:14748154-14748176 CAGGATTAAATGGAAAAATATGG - Intergenic
926849788 2:17182832-17182854 AAGGATTGACTGAAAAAATAAGG + Intergenic
928737154 2:34305410-34305432 CATGATTAAGTTTATAAATATGG + Intergenic
929223848 2:39492471-39492493 GAAGATAAACTGCAGAAATAGGG - Intergenic
929722879 2:44389012-44389034 GAGCATCAACTGTAGTAATACGG + Intronic
932087225 2:68773164-68773186 AAGGATGAAATGTGGAAATAGGG + Intronic
932095343 2:68842662-68842684 CATTATTAACTGAAGAAAAATGG + Intergenic
934739330 2:96707825-96707847 CATGATTATCTGAAGAAAAATGG + Exonic
935464461 2:103380184-103380206 CAAGATTAGCTGAAGAAATAAGG - Intergenic
935473272 2:103485383-103485405 CATTATTAACTGAAGAAAAATGG - Intergenic
935923809 2:108044798-108044820 CATTATTAACTGAAGAAAAATGG + Intergenic
939830891 2:147069379-147069401 CAGGATGAATTAGAGAAATAGGG + Intergenic
940369290 2:152882198-152882220 CATTATTAACTGAAGAAAAATGG + Intergenic
940771448 2:157843438-157843460 GAGGATTAAGTGTGGTAATATGG - Intronic
941548763 2:166888476-166888498 CAGGATTATTTGGAGAAATCTGG + Exonic
941681666 2:168406498-168406520 CATTATTAACTGAAGAAAAATGG - Intergenic
942030455 2:171954057-171954079 CAGGATTAACTGTAATGACAGGG - Intronic
942088817 2:172467989-172468011 CAGGAATCACAGGAGAAATAAGG - Intronic
942999580 2:182308951-182308973 TAGGATAAGTTGTAGAAATAAGG - Intronic
943164582 2:184304305-184304327 CAGGATGAACTGTATAAAAAAGG - Intergenic
944665905 2:201959437-201959459 AAGGATAAACTCGAGAAATATGG + Intergenic
944959886 2:204860042-204860064 CAGGATTAACTGTAGAAATACGG + Intronic
945593446 2:211763165-211763187 CAGGATAAAATGTACAAATATGG - Intronic
945730040 2:213522382-213522404 CAGGATTGCCTCTAGAAATTAGG - Intronic
945905437 2:215587764-215587786 CAGGAATAAATGTAGGACTACGG + Intergenic
948503870 2:238414942-238414964 AAGGATCAACTTTAGAAAGATGG - Intergenic
1169033969 20:2434653-2434675 CACAATTAACTGAAGAAAAACGG - Intergenic
1170967652 20:21089861-21089883 GAGGATTCACTGTCCAAATATGG + Intergenic
1173094866 20:40015984-40016006 CAGCATTAAGTGTAGAATAAAGG + Intergenic
1173905071 20:46621365-46621387 CATTATTAACTGAAGAAAAATGG - Intronic
1174464828 20:50709122-50709144 CTTTATTAACTGTAAAAATAAGG - Intergenic
1175589305 20:60174971-60174993 CATTATTAACTGAAGAAAAATGG + Intergenic
1175627087 20:60498106-60498128 CAGGATTCACTGTTGGAAAATGG + Intergenic
1177550875 21:22620812-22620834 TATAATTAACTGTAGAGATAAGG + Intergenic
1178059414 21:28835130-28835152 CAGCATTAGCTGTAGTAGTATGG - Intergenic
1178193677 21:30317880-30317902 CAAGATTAACAGTAGACATATGG + Intergenic
1182170585 22:28224733-28224755 CAGGAGGAACTGTAGAATGAAGG - Intronic
1183861288 22:40672148-40672170 CAGGAGTGACAGTAGAAAGAAGG + Intergenic
949352956 3:3144210-3144232 CAGGATTAACAGAAGAAACGAGG - Intronic
950092048 3:10302798-10302820 GAGGAATAAGTGTAGAAACAGGG + Intronic
951231519 3:20185541-20185563 CAGGACTAATTGGAGAATTATGG - Intronic
951459503 3:22934748-22934770 TGGGATTAGATGTAGAAATATGG - Intergenic
951833112 3:26951933-26951955 CAGGATTAACAGTGGCAAAATGG + Intergenic
953137898 3:40199380-40199402 CAGGATTAAGTGTGGGCATATGG + Intronic
953224571 3:41005572-41005594 CATTATTAACTGAAGAAAAATGG - Intergenic
953424807 3:42786361-42786383 CAGGATTATCTTTAAAAACATGG + Intronic
956923636 3:73958076-73958098 CATTATTAACTGAAGAAATATGG - Intergenic
957661778 3:83165154-83165176 ATGGATTAAATGTAAAAATATGG - Intergenic
960334892 3:116404783-116404805 CAGAATTTACAGGAGAAATATGG + Intronic
961421491 3:126808645-126808667 CATTATTAACTGAAGAAAAATGG + Intronic
961513977 3:127421500-127421522 TAGGATTTACTTCAGAAATAGGG - Intergenic
962883614 3:139602219-139602241 AAGGAATCACTGTAGAAATCAGG + Intronic
963624538 3:147654411-147654433 CAGTATTATCTGTAGAAATCTGG - Intergenic
963733977 3:148998754-148998776 CAGTATAAGCAGTAGAAATAAGG - Intronic
965813133 3:172612392-172612414 CATTATTAACTGAAGAAAAATGG + Intergenic
968177158 3:196560844-196560866 TAGCATTAAATGTAGAAATAAGG + Intronic
969255781 4:6000772-6000794 CAGTATTTACTGAAGAAACAGGG + Intergenic
972439071 4:39067582-39067604 GAGAATTAACTGAAGAAAGAAGG - Intronic
973101973 4:46283547-46283569 CAGGGCTATCTGTAGAACTAAGG + Intronic
974738499 4:65973275-65973297 CAGTATATACTGCAGAAATAGGG - Intergenic
975929314 4:79499591-79499613 CAGGATTAACTAAAGAGAGAAGG - Intergenic
976240260 4:82948090-82948112 AATGATTAAATGTATAAATATGG + Intronic
976554348 4:86433017-86433039 CAGGATCAACTGTAGCAACAGGG + Intronic
977378114 4:96235390-96235412 AAGAATAAAGTGTAGAAATAGGG + Intergenic
977409346 4:96641672-96641694 CAGGATGTATTGAAGAAATATGG - Intergenic
978215231 4:106193032-106193054 AATGCTTAAATGTAGAAATATGG - Intronic
980501719 4:133664184-133664206 TAAAATTAACTGTAGTAATAAGG - Intergenic
980820546 4:138010472-138010494 CATTATTAACTGAAGAAAAATGG + Intergenic
983518039 4:168677811-168677833 CAGGATTAACTGGCGGAGTAGGG - Intronic
983607636 4:169608018-169608040 CAGCATTAACTGTAGAGATTAGG - Intronic
984396152 4:179202462-179202484 CATTATTAACTCTTGAAATATGG + Intergenic
986465378 5:8015985-8016007 CAGGGTTAACTGGAGAAAGTGGG + Intergenic
992475094 5:77094283-77094305 CATCATTAACTGAAGAAAAATGG + Intergenic
992704784 5:79380164-79380186 CAGGATTCATGGTGGAAATATGG - Intronic
992866667 5:80963147-80963169 CTGGATAAACTGTAGATTTAAGG - Intronic
993292303 5:86089839-86089861 CATTATTAACTGAAGAAAAATGG - Intergenic
993617871 5:90135759-90135781 CAGCATTAAGTGTAGTAACATGG - Intergenic
994797900 5:104330126-104330148 GAGGATTTACTGTATTAATATGG + Intergenic
995051120 5:107705112-107705134 CAGGATAATCTATTGAAATATGG - Intergenic
995279339 5:110315939-110315961 CAGGGTCAACTGCAGAAACAAGG - Intronic
995415165 5:111902887-111902909 CATTATTAACTGAAGAAAAATGG - Intronic
995984120 5:118147504-118147526 CAAGATTAAAGGTAGAAATGTGG - Intergenic
996092618 5:119365493-119365515 CAGGAGGTACTGTATAAATAAGG + Intronic
996598983 5:125239317-125239339 CATTATTAACTGAAGAAAAATGG + Intergenic
996675444 5:126169511-126169533 AAATATTAACTGAAGAAATATGG - Intergenic
998928390 5:147153333-147153355 CATTATTAACTGAAGAAAAATGG - Intergenic
1000242811 5:159424337-159424359 AAGGATTAACTGTACAGTTAGGG + Intergenic
1001775994 5:174329380-174329402 CAGGAGTAAATGCAGAAAGAGGG + Intergenic
1002687292 5:181023851-181023873 CAGGATTAACTCAAAAAAAAAGG + Intergenic
1003933307 6:10950005-10950027 TAGGGTTAACTTTAGAAATAGGG - Intronic
1005001956 6:21250347-21250369 CATGATTAACTGAAGAGAAATGG + Intergenic
1009287064 6:61832307-61832329 AAGGATTGACTTTAGAAACAAGG + Intronic
1009445324 6:63735986-63736008 TAGTATTAACTGTAGTGATACGG - Intronic
1009564527 6:65295334-65295356 CAAGATTCAGTGTAGTAATAAGG - Intronic
1011197377 6:84795218-84795240 CAGGAGTAACTGCAGCATTAAGG + Intergenic
1011922509 6:92597800-92597822 AAAGATTAACAGTAGAAAGATGG + Intergenic
1012077716 6:94713388-94713410 GAGGATTAACTGAACAACTATGG - Intergenic
1012793776 6:103734537-103734559 CAGCATCAACTGTAGTAGTATGG - Intergenic
1013468769 6:110441855-110441877 CACTATTAACTGAAGAAAAATGG - Intronic
1015249615 6:131113366-131113388 CATTATTAACTGAAGAAAAATGG + Intergenic
1016301994 6:142642996-142643018 CATTATTAACTGAAGAAAAATGG - Intergenic
1016616435 6:146053855-146053877 CAGTTTTAACTGAAGAGATAAGG + Intronic
1017299436 6:152838842-152838864 CACTATTAACTGAAGAAAAATGG + Intergenic
1019796438 7:3053012-3053034 GATGATTAACAGCAGAAATAAGG - Intergenic
1020843009 7:13244323-13244345 CAATTTTAACTGGAGAAATAAGG - Intergenic
1021434067 7:20594470-20594492 CAGGAGTAATTGAAGAAAAAGGG + Intergenic
1024095877 7:45982453-45982475 CAGGTTTAAGTATAGAAATGAGG + Intergenic
1027747169 7:82091331-82091353 CCAAATTAACTGTAGGAATAAGG - Intronic
1028935289 7:96457081-96457103 CATGACCAGCTGTAGAAATAAGG + Intergenic
1029952208 7:104598829-104598851 CATTATTAACTGAAGAAAAATGG - Intronic
1030010761 7:105164480-105164502 CATTATTAACTGAAGAAAAATGG - Intronic
1032296743 7:130645602-130645624 CATTATTAACTGAAGAAACATGG + Intronic
1033287172 7:140051352-140051374 CATTATTAACTGAAGAAAAATGG + Intronic
1035402941 7:158579358-158579380 CAACATTAACTGTAGAAACCTGG + Intronic
1037092217 8:14934358-14934380 CAGGATTGAAAGTATAAATAAGG + Intronic
1038188675 8:25298930-25298952 CAGGATTGACTGAACAAAGAGGG - Exonic
1038484956 8:27928410-27928432 TAGGATTAAGTGTATTAATATGG - Intronic
1039169808 8:34730978-34731000 CATTATTAACTGAAGAAAAATGG + Intergenic
1040859822 8:51987471-51987493 CAGGAATAACTGTTGCAATAGGG - Intergenic
1041589696 8:59563214-59563236 CATTATTAACTGGAGAAAAATGG - Intergenic
1042467093 8:69140663-69140685 AAGCATCAACTGTAGTAATAAGG + Intergenic
1043632299 8:82351369-82351391 CACCATTAAGTATAGAAATATGG + Intergenic
1044582445 8:93835621-93835643 CAGGAAGAAATGAAGAAATACGG - Intergenic
1045412754 8:101935261-101935283 CGGGATTAACTGTGGAAACCAGG - Intronic
1045913566 8:107439535-107439557 AACGAATATCTGTAGAAATAAGG + Intronic
1046286553 8:112100131-112100153 CAGGATTAACTTTCAAAAAATGG - Intergenic
1046988925 8:120427258-120427280 CAGTATTATCTTTAAAAATAAGG - Intronic
1047911727 8:129537215-129537237 CAGGATAATCTGGACAAATAGGG - Intergenic
1048489047 8:134874930-134874952 CATTATTAACTGAAGAAAAATGG + Intergenic
1050673321 9:8023200-8023222 CATTATTAACTGAAGAAAAACGG - Intergenic
1051539278 9:18196418-18196440 CAGGCTTAATTGTAAAAATGTGG + Intergenic
1052181924 9:25539830-25539852 GAAGATTAGCTGTAGATATATGG + Intergenic
1054793804 9:69279901-69279923 CAGCATAATCTTTAGAAATAGGG - Intergenic
1055605336 9:77963920-77963942 CATTATTAACTGTAGAAAAATGG - Intronic
1055747267 9:79462983-79463005 CAGAATGAAATGTAGAAATGAGG + Intergenic
1056822661 9:89854473-89854495 AAGGATTAACTGTAGAGAAAGGG - Intergenic
1061040306 9:128137811-128137833 AAGGATTAACTGTAGAGAAAGGG + Intergenic
1061513000 9:131072262-131072284 CAGGACTCACTGTGGAAATAGGG + Intronic
1186457874 X:9724626-9724648 CACTATTAACTGAAGAAAAATGG - Intergenic
1186691059 X:11976135-11976157 CAGGATTAACGGGAGAAAAGAGG - Intergenic
1186848670 X:13557347-13557369 CATGATTAACTGAGGAAAAATGG + Intergenic
1186970946 X:14842117-14842139 CAGGATTAATCGTAGAAATCTGG - Intergenic
1188120253 X:26297292-26297314 CATTATTAACTGAAGAAAAATGG - Intergenic
1189094975 X:38128538-38128560 CAAGATGAAATCTAGAAATATGG - Exonic
1189109698 X:38275922-38275944 CTGGATTAACTTCAGAAGTATGG - Intronic
1189684140 X:43546217-43546239 CAGCATTAACTGAAGAAAAATGG + Intergenic
1189994893 X:46628933-46628955 CAGGAGGAACTGGAGAAATAAGG + Intronic
1191599014 X:62982861-62982883 CTGGATAAACTGTAAAATTAAGG - Intergenic
1191951544 X:66598766-66598788 ATGTATTAACTGAAGAAATACGG + Intronic
1192003484 X:67182877-67182899 CATTATTAACTGAAGAAAAATGG + Intergenic
1194273305 X:91847505-91847527 AAGGAATTACTGTAGAAATTTGG - Intronic
1194931654 X:99895782-99895804 CATTATTAACTGAAGAAATATGG + Intergenic
1195132089 X:101863188-101863210 CAGGACTATCTGTAGAGAAAGGG + Intergenic
1196125551 X:112095100-112095122 CAGGATTAACCTTAGAAAGGAGG + Intergenic
1197132439 X:123020301-123020323 GAGCATTAGCTGTAGAAATATGG - Intergenic
1198500532 X:137241179-137241201 CATTATTAACTGTAGAAAAATGG + Intergenic
1198734332 X:139769954-139769976 CAGTATACACTGAAGAAATATGG - Intronic
1200166873 X:154042001-154042023 CAGTATTAGCTGCAGAATTACGG + Intronic
1200590549 Y:5068918-5068940 AAGGAATTACTGTAGAAATTTGG - Intronic
1201578142 Y:15482404-15482426 CAGGAGGTACTGTAAAAATATGG + Intergenic
1201757777 Y:17505662-17505684 CATTATTAACTGTAGAAAATGGG + Intergenic
1201843777 Y:18400320-18400342 CATTATTAACTGTAGAAAATGGG - Intergenic
1202172632 Y:22067075-22067097 CAGGATTAAGTTTAGGGATATGG - Intergenic
1202218730 Y:22519296-22519318 CAGGATTAAGTTTAGGGATATGG + Intergenic
1202324456 Y:23676759-23676781 CAGGATTAAGTTTAGGGATATGG - Intergenic
1202546315 Y:25993295-25993317 CAGGATTAAGTTTAGGGATATGG + Intergenic