ID: 944961585

View in Genome Browser
Species Human (GRCh38)
Location 2:204880704-204880726
Sequence GGATACTTCTTGGAGATAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944961585_944961592 20 Left 944961585 2:204880704-204880726 CCTGTTATCTCCAAGAAGTATCC 0: 1
1: 0
2: 0
3: 7
4: 120
Right 944961592 2:204880747-204880769 CAAATGACTTTTGCATGGACAGG 0: 1
1: 0
2: 0
3: 11
4: 117
944961585_944961593 28 Left 944961585 2:204880704-204880726 CCTGTTATCTCCAAGAAGTATCC 0: 1
1: 0
2: 0
3: 7
4: 120
Right 944961593 2:204880755-204880777 TTTTGCATGGACAGGATATCTGG 0: 1
1: 0
2: 0
3: 12
4: 113
944961585_944961589 -10 Left 944961585 2:204880704-204880726 CCTGTTATCTCCAAGAAGTATCC 0: 1
1: 0
2: 0
3: 7
4: 120
Right 944961589 2:204880717-204880739 AGAAGTATCCAGCTGATGTGGGG 0: 1
1: 0
2: 0
3: 9
4: 145
944961585_944961591 15 Left 944961585 2:204880704-204880726 CCTGTTATCTCCAAGAAGTATCC 0: 1
1: 0
2: 0
3: 7
4: 120
Right 944961591 2:204880742-204880764 GCACACAAATGACTTTTGCATGG 0: 1
1: 0
2: 3
3: 13
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944961585 Original CRISPR GGATACTTCTTGGAGATAAC AGG (reversed) Intronic
909462214 1:75929814-75929836 GGATATGTTTTGGAGATAACAGG + Intronic
909520595 1:76563928-76563950 GGATCCTTCTTGTACATAATGGG - Intronic
911927043 1:103846349-103846371 GGATACTAACTGGAAATAACTGG + Intergenic
918962456 1:191297975-191297997 GAAAACTTCTTGGAGTTCACAGG - Intergenic
919824258 1:201492607-201492629 TGATACTGCTTGGAAATAAAGGG + Intronic
922546761 1:226463908-226463930 AGGTACATCTAGGAGATAACTGG + Intergenic
1063058847 10:2529797-2529819 GTATACTGCTTGGAGCTAATAGG - Intergenic
1064567593 10:16658062-16658084 GGATTCTTCTAGGGGATAACAGG + Intronic
1066501919 10:36003119-36003141 GGATCCTTCGTGGAGACAATGGG - Intergenic
1069393624 10:67964446-67964468 GAATATGTCTTGGAGATAAAAGG - Intronic
1072308579 10:94132367-94132389 GGTTGCTTCTAGGAGAGAACCGG - Exonic
1073702197 10:105940094-105940116 GGAGACCTCTGGGAGACAACAGG - Intergenic
1075425007 10:122334917-122334939 GGATTCTTCTTTAAGATAAAGGG + Exonic
1076238253 10:128882722-128882744 GGGTCCTTCTTGGAGATGAGAGG - Intergenic
1079489554 11:20972377-20972399 GGCTAATTCTTGGAGTTAGCAGG + Intronic
1110395431 13:75024663-75024685 GGATTCATCTTGGATATAAAAGG - Intergenic
1115979010 14:39029473-39029495 GGATAATTTTTGGAGAAAAGAGG + Intergenic
1116514961 14:45793979-45794001 GGAAAATTCTTAGAAATAACTGG + Intergenic
1116718410 14:48458491-48458513 TGATACTTATTTGAAATAACCGG + Intergenic
1118782899 14:69021780-69021802 GGATAATACATGGATATAACCGG + Intergenic
1119241577 14:73064697-73064719 GGATATTCCTTTAAGATAACTGG - Intronic
1122388444 14:101364473-101364495 GGAAACTGCTTAGAGATAACTGG - Intergenic
1123776474 15:23585412-23585434 AGATACTTCTTGGAAACCACAGG + Intronic
1123947579 15:25246225-25246247 GGTTAGGTCTTGGAGATAAAAGG + Intergenic
1125879663 15:43183110-43183132 GGATACATCTTGGAGAAATCAGG - Intronic
1126255137 15:46616547-46616569 GGAAACCTGTAGGAGATAACTGG - Intergenic
1126452701 15:48826845-48826867 GGAGGCTTCTTGGAGAAGACAGG - Intronic
1128325108 15:66719235-66719257 GGATACTTGTTGTAGAACACTGG - Intronic
1133313553 16:4867513-4867535 GGAAATTTCTCAGAGATAACTGG + Intronic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1135798802 16:25473091-25473113 GGAACCCTCTTGGAGTTAACTGG - Intergenic
1137019012 16:35404668-35404690 AGATATATCTTGGAGATATCTGG - Intergenic
1139155755 16:64439939-64439961 TGATACTTCTTTGAAATAAGTGG - Intergenic
1140324237 16:73985820-73985842 GGATATTTTATGGAGATAAAAGG + Intergenic
1145239771 17:21233862-21233884 GGATTTTACTTGGAGATCACGGG - Intergenic
1146986115 17:37220029-37220051 GGAGACTTCAGGGAGATTACAGG + Intronic
1150417829 17:65001728-65001750 GGATACTTCAGGCAGAAAACTGG - Intergenic
1150793820 17:68222067-68222089 GGATACTTCAGGCAGAAAACTGG + Intergenic
1155130572 18:22930727-22930749 GGCTAGTTCCTGGAGATAAAAGG + Intronic
1158077625 18:53549080-53549102 TGATATTTCTTGTAGATAAATGG + Intergenic
1158716423 18:59884045-59884067 GGATACCATTTGGAGATCACTGG + Intergenic
1159888199 18:73930104-73930126 AGAAAGTTCTTGGAGATAATGGG - Intergenic
1161645869 19:5453106-5453128 GGACACTTCTTGGAAATCCCAGG - Intergenic
1164572903 19:29386908-29386930 GGATTCGTCTTTGGGATAACTGG - Intergenic
925410634 2:3638019-3638041 GGATGGTTCTTGGTGAGAACAGG + Intronic
929693801 2:44097251-44097273 GGCAGCTTCTTGGTGATAACTGG + Intergenic
932116570 2:69055364-69055386 GGAGACTTCTTCCAGATAAGGGG + Intronic
936103054 2:109600317-109600339 GGAGATTTCTTGGAGATGAGGGG - Intronic
938569685 2:132551298-132551320 GAAGACTTCTTGGACATATCTGG - Intronic
939002375 2:136751321-136751343 AGATTCTTCTTGGATATCACGGG + Intergenic
939114572 2:138045584-138045606 GGATTGTTCTTGGACATAAATGG + Intergenic
941823144 2:169862897-169862919 GGATAATTCATGGAGATTCCTGG - Intronic
943279070 2:185908382-185908404 GACTAGGTCTTGGAGATAACAGG + Intergenic
943376223 2:187080199-187080221 GGAGATTTCATGGAGACAACAGG + Intergenic
944220461 2:197299056-197299078 GCACACTTCTTTGAGATAATTGG - Intronic
944961585 2:204880704-204880726 GGATACTTCTTGGAGATAACAGG - Intronic
946747345 2:222859840-222859862 GGATACATCCTGAAGATAAATGG - Intergenic
947073991 2:226321005-226321027 AGACAATTCTTGGAGATACCTGG + Intergenic
1169079127 20:2784319-2784341 GGATACTGCTCAGAGATAAAAGG + Intergenic
1169968143 20:11239762-11239784 CAATCCTTCATGGAGATAACTGG - Intergenic
1172822026 20:37745076-37745098 GTATACTTTTTGTAGAAAACCGG - Intronic
1182783588 22:32887691-32887713 GAATGCTTCTTGGGGATAAAAGG - Intronic
1183031054 22:35104799-35104821 GGGTACTTTTGGAAGATAACGGG + Intergenic
949370187 3:3326153-3326175 TGATACTTATTGGAGATATAAGG + Intergenic
953282346 3:41571578-41571600 GATTTCTTCTTGGACATAACTGG + Intronic
957478997 3:80767150-80767172 GGATACACCTTGCAGATAAAAGG - Intergenic
957505485 3:81115333-81115355 GGAAACTTCTTAGAGATTAGTGG + Intergenic
958204054 3:90365826-90365848 GGATACTTCTAGGAGATCTGAGG - Intergenic
960239373 3:115322511-115322533 GGATACTTCCTGGGTATAAGAGG - Intergenic
962818721 3:139025881-139025903 GGTTAATACTTGGAGATAATTGG - Intronic
963296526 3:143552692-143552714 AGATTCTTCCTGGAGATAAACGG + Intronic
966623311 3:181989228-181989250 GGATATTTCTTAGAGAAGACTGG + Intergenic
968450418 4:673683-673705 GGCTGCTTCTTGGTGAAAACGGG - Intronic
969433213 4:7168144-7168166 TGACACTTCTTGGAGAGAAGAGG + Intergenic
969464817 4:7350002-7350024 AGATATTTCTTGGTGACAACTGG - Intronic
971643910 4:29171613-29171635 GGATACTTCTGGAAGGGAACAGG - Intergenic
972267607 4:37477898-37477920 GGATACTGCTCGCAGATCACAGG - Intronic
974284874 4:59851458-59851480 TGATATTTCTTAGAGATAAAAGG + Intergenic
974953910 4:68615530-68615552 GGAGACTTCTTTGAGATCCCTGG + Intronic
975310013 4:72893342-72893364 GGATGCTTTTTGGAGATAAAGGG - Intergenic
978634466 4:110787572-110787594 GTTTACTTGTTAGAGATAACAGG - Intergenic
978947005 4:114511847-114511869 GGATAGTTCTTGGAGGTGAATGG - Intergenic
978990387 4:115074754-115074776 GGATACTTCTTCAAAATAACAGG - Intronic
979203165 4:118003558-118003580 GCTTACTCCTTGGAGATACCAGG - Intergenic
980383683 4:132059327-132059349 GGATACTTTATGAAGACAACAGG - Intergenic
981234594 4:142400185-142400207 GCTTATTACTTGGAGATAACCGG - Intronic
981827406 4:148959329-148959351 TGAAACTTCTGGGAAATAACTGG + Intergenic
982144274 4:152365689-152365711 TGAGATATCTTGGAGATAACTGG + Intronic
986812355 5:11373646-11373668 GGATGCTTCTTGGAGAAGCCTGG - Intronic
987548587 5:19347110-19347132 GGAGACTTCTGGGAAATAGCTGG - Intergenic
988949669 5:36243176-36243198 GGAAAGTTCTTGGTGAGAACGGG - Intergenic
996035844 5:118757954-118757976 GGATACATCTGAGAGATGACAGG - Intergenic
996288174 5:121819967-121819989 GCATACTTTTTGGAGCTCACGGG - Intergenic
998076226 5:139238701-139238723 AGATACTGCTTGGAGAGAATTGG + Intronic
998856789 5:146401617-146401639 GGCCACATCTTGGATATAACTGG - Intergenic
1000627087 5:163551095-163551117 GGATACTCATTGTAGAAAACAGG + Intergenic
1000760035 5:165211752-165211774 GAATCCTTCTTGGAGAAGACAGG - Intergenic
1002665947 5:180825208-180825230 GGAGACATCTTGGGGATAAAGGG - Intergenic
1004160560 6:13209163-13209185 AGATTCTTCCTGGAGATGACTGG - Intronic
1011322605 6:86113436-86113458 GTATACTTCTTGTAGGCAACAGG + Intergenic
1012198323 6:96373404-96373426 GAACACTTCTTGAAGAAAACAGG + Intergenic
1012206728 6:96470264-96470286 TGACACTTCTTGAAGATAATTGG - Intergenic
1013051817 6:106543396-106543418 GGATACTTCTTACAGATTACTGG + Intronic
1018808671 6:167281429-167281451 GAATACTTCTTGTAGCTAAAAGG + Intronic
1019441227 7:1048218-1048240 GGAAACTTCGTGGGGATCACCGG + Intronic
1020436743 7:8172309-8172331 GGATATTTATTGAAGATAATAGG - Intronic
1020859009 7:13464627-13464649 GGATACTTCTTATATACAACAGG - Intergenic
1021447670 7:20750820-20750842 GGATATTTCTATGAGATAAGTGG - Intronic
1022376575 7:29818097-29818119 GGATACTTTTTGGAGTTTATTGG + Intronic
1024273121 7:47657279-47657301 GGCTACATCTTGGAGGTCACGGG - Intronic
1031215542 7:118885553-118885575 GGATATTTCTTGTAGGCAACAGG - Intergenic
1033102890 7:138491241-138491263 TGATATTTCTTGGACATAGCAGG + Intronic
1035403247 7:158582016-158582038 GCAGAGTTCTTAGAGATAACAGG + Intronic
1037178697 8:15976711-15976733 AGATGCTGCTTGGAGAGAACTGG - Intergenic
1045496953 8:102717120-102717142 GGATAATTCTTGGTTACAACTGG + Intergenic
1046252368 8:111649454-111649476 CGATATTGCTTGGAGATAGCAGG - Intergenic
1048041616 8:130734805-130734827 GGGTACTTCTTATAGATATCAGG - Intergenic
1048050306 8:130810081-130810103 GGATACACCTGGGAGATACCTGG + Intronic
1049028809 8:140017048-140017070 GAACACTTTTCGGAGATAACAGG + Intronic
1050119233 9:2291227-2291249 GGATCATTCTTGGGGATTACGGG + Intergenic
1050695966 9:8279418-8279440 GGATACTTCATTGAGAAAGCTGG + Intergenic
1057789910 9:98118106-98118128 GAAGACTTCTTGGAGACAAGTGG + Intronic
1058674323 9:107387756-107387778 GAAGACTTCTTAGAGTTAACTGG + Intergenic
1059059251 9:111017660-111017682 GTATACTTCTGTGAAATAACTGG - Intronic
1059707283 9:116837121-116837143 GGAAATTGCTTAGAGATAACTGG - Intronic
1187696229 X:21923923-21923945 GGATAATTCTGGCACATAACAGG - Intergenic
1194487338 X:94501403-94501425 GGATACTTCCAGGAGAAAAGTGG - Intergenic
1195427068 X:104746333-104746355 GGTTACTTCTAGGAGAGCACTGG + Intronic