ID: 944962481

View in Genome Browser
Species Human (GRCh38)
Location 2:204890718-204890740
Sequence CCTGCTAGCCACAGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 1, 1: 0, 2: 0, 3: 47, 4: 426}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944962481 Original CRISPR CCTGCTAGCCACAGGGAGGC AGG Intronic
900334749 1:2156843-2156865 CCTGCTCTCCACTGGGAGTCTGG - Intronic
900432051 1:2607097-2607119 CACGTGAGCCACAGGGAGGCTGG - Intronic
900880330 1:5376977-5376999 CCCTCTAGCCACAGGGAGCTGGG + Intergenic
905202086 1:36322345-36322367 CCTGCTGGGCACAGGCACGCTGG - Exonic
905292791 1:36934243-36934265 CATGCCAGCCAGAGGGAGGGAGG - Intronic
906253079 1:44326318-44326340 CCTCCTGGCCACAGGGAAGAGGG + Intronic
906543952 1:46608472-46608494 ACAGCTATCCACAGGGAGACTGG - Exonic
907272530 1:53299229-53299251 GCTGCTACCCACAGGCAGGCAGG + Intronic
907530173 1:55087685-55087707 CCTACTAGACACAAAGAGGCTGG - Intronic
908191485 1:61708164-61708186 GGTCCTAGCCACTGGGAGGCTGG - Intronic
909770222 1:79413022-79413044 CCTGATAGAAACAGGGTGGCAGG + Intergenic
911508542 1:98784118-98784140 CCTGCTGGAGCCAGGGAGGCTGG + Intergenic
911725890 1:101240238-101240260 GCTGCAAGCCAGAGGGAGGAAGG + Exonic
912547418 1:110460936-110460958 CCTGGTATCCAGAGGGAGGCCGG + Intergenic
913541177 1:119822453-119822475 CCTGCTGGAGCCAGGGAGGCTGG - Intergenic
915328043 1:155091506-155091528 CCTGCTACCCACAGCGCTGCTGG - Intergenic
915625774 1:157113289-157113311 CCCACCAGCCACAGGCAGGCAGG - Intergenic
917024882 1:170631191-170631213 CCTGCTGGAGCCAGGGAGGCTGG - Intergenic
917060575 1:171033112-171033134 CCTGCTGGAGCCAGGGAGGCTGG - Intronic
917079058 1:171237653-171237675 CCTGCTGGAGCCAGGGAGGCTGG + Intergenic
918802267 1:188986824-188986846 CCTGCTGGAGCCAGGGAGGCTGG - Intergenic
918943162 1:191027174-191027196 CCTGCTGGAGCCAGGGAGGCTGG + Intergenic
919428720 1:197466924-197466946 CGTGCAAGGCACAGGCAGGCAGG + Intronic
920226603 1:204443597-204443619 CCTGCAAGGCAGAGGGAGTCAGG + Exonic
921080112 1:211732338-211732360 CCTGTTACTCACGGGGAGGCTGG + Intergenic
921251304 1:213300923-213300945 CCTGACTGCCACAGGGAGGGTGG + Intergenic
922173688 1:223178427-223178449 CCTGTAAGCCAAGGGGAGGCTGG + Intergenic
922204567 1:223435232-223435254 CCTGCTAATCTCAGAGAGGCAGG + Intergenic
923471409 1:234294204-234294226 CCTGCAACACCCAGGGAGGCAGG + Intronic
1066659947 10:37728824-37728846 CATGCTGGCCACTGGGTGGCAGG - Intergenic
1066758874 10:38736648-38736670 CATGCTGGCCACTGGGTGGCAGG - Intergenic
1066962762 10:42236120-42236142 CGTGCTGGCCACTGGGTGGCAGG + Intergenic
1067409014 10:46048465-46048487 CCAGCTGCCCACAGGGAGGAAGG + Intergenic
1067711792 10:48656167-48656189 CCTGCTCATCACACGGAGGCCGG - Intronic
1070327261 10:75397008-75397030 CCTGGTAGCCCCAGAAAGGCCGG + Intergenic
1070533848 10:77360822-77360844 TCTGCAGGCCACAGGGAGGGAGG + Intronic
1070842668 10:79498483-79498505 CCTGGAAGCCACATGGAGACGGG - Intergenic
1070883677 10:79871167-79871189 CCTGTCACCCACAGGGAGGGAGG + Intergenic
1071650236 10:87387477-87387499 CCTGTCACCCACAGGGAGGGAGG + Intergenic
1072434903 10:95405934-95405956 CCTGCAAGCTCCAGGGAGGCAGG + Intronic
1073896653 10:108168216-108168238 CATGAGAGCCACAGGGAGCCAGG + Intergenic
1075172386 10:120127821-120127843 CCTGCTGGAGCCAGGGAGGCTGG - Intergenic
1075230333 10:120671191-120671213 CCTGGGAGCCACAGGGAGCAAGG + Intergenic
1075544650 10:123345901-123345923 CCGGCAAGCTACAGAGAGGCGGG + Intergenic
1075559375 10:123457226-123457248 CCAGCTTGCCCCAGAGAGGCAGG - Intergenic
1076210861 10:128643836-128643858 CCTGTTAGTCACAGAGAAGCAGG - Intergenic
1076364285 10:129911821-129911843 CCTCTCACCCACAGGGAGGCCGG + Intronic
1076703769 10:132290102-132290124 TCTGCTGGCCATAGGGTGGCCGG - Intronic
1076905707 10:133359749-133359771 CATGCTGGCCCCAGGGAGCCTGG - Intergenic
1077459562 11:2702037-2702059 CCTGGGGGCCACAGTGAGGCTGG - Intronic
1077910129 11:6566136-6566158 CCTATCAGCCACAGGGAAGCTGG + Intronic
1079085819 11:17444209-17444231 CCTGTTAAACACTGGGAGGCAGG - Intronic
1082952376 11:58831024-58831046 GCTGCAAGCTACAGGGAGCCAGG + Intergenic
1083587251 11:63869295-63869317 CCTGCTCGCGGCAGGCAGGCAGG + Intronic
1085854567 11:80161638-80161660 CCTCCTCACCACAGGGAGGGAGG - Intergenic
1088084462 11:105960476-105960498 CCTGCTGGAGCCAGGGAGGCTGG - Intronic
1088697710 11:112382689-112382711 CCTGCTGGAGCCAGGGAGGCTGG + Intergenic
1088853138 11:113721812-113721834 CCTGGTAGCCACATGGGGGATGG - Intergenic
1089230232 11:116967819-116967841 CCTGATGGGCACAGGGAGGCTGG - Intronic
1089526079 11:119097596-119097618 CCTATTAGCCACAGGGAGGAGGG - Intronic
1089539797 11:119182949-119182971 GCTGCTGGCCAGTGGGAGGCAGG - Intronic
1090425169 11:126602579-126602601 CGTTCAAGCCAAAGGGAGGCAGG - Intronic
1091767371 12:3130394-3130416 CTTGCTGGCCACAGCAAGGCAGG + Intronic
1092343367 12:7695061-7695083 CCTGCTTGCCACATGGAAGACGG + Intronic
1092628606 12:10354797-10354819 CCTGCTGGAGCCAGGGAGGCTGG - Intergenic
1093303287 12:17479421-17479443 CCTGCTAGAGGCAGGGAGGCCGG + Intergenic
1093522488 12:20067059-20067081 CCTGCTGGAGCCAGGGAGGCTGG + Intergenic
1093808444 12:23464546-23464568 CCTGCTGGAGGCAGGGAGGCTGG + Intergenic
1094054550 12:26256005-26256027 CCTGCTGGAGCCAGGGAGGCTGG + Intronic
1094275318 12:28668716-28668738 CCTGCTGGAACCAGGGAGGCTGG + Intergenic
1094329169 12:29273496-29273518 CCTGCTAGTGCCAGGAAGGCTGG - Intronic
1096254697 12:50055971-50055993 CCTGCGAGCCGCGGGGAGGTGGG + Intergenic
1096384918 12:51188929-51188951 CTTTCCAGCCACAGTGAGGCTGG + Exonic
1097598521 12:61664152-61664174 CCTGCCAGCTCCAGGGAGTCTGG - Intergenic
1097696463 12:62779745-62779767 AGTGATAGCCACAGGCAGGCAGG - Intronic
1100115138 12:91294784-91294806 CCTGCTAGCTCCAGAGAGTCAGG + Intergenic
1100454100 12:94734981-94735003 CGTGTTAGGCACAGTGAGGCAGG + Intergenic
1101066531 12:101027517-101027539 CCTGCTGGAGCCAGGGAGGCTGG + Intronic
1101131715 12:101697573-101697595 CCTGCTAGGGGCGGGGAGGCGGG - Intronic
1101331176 12:103759004-103759026 CCTGATCTCCACATGGAGGCAGG + Intronic
1101995404 12:109521932-109521954 CCAGATGGCCACACGGAGGCTGG + Intronic
1102991386 12:117318733-117318755 TGTGCTGGGCACAGGGAGGCGGG + Intronic
1103561738 12:121796457-121796479 CCAGCCAGCCCCAGTGAGGCTGG + Intronic
1103902187 12:124309074-124309096 CCTGCATGCCAGGGGGAGGCAGG + Intronic
1104287101 12:127433282-127433304 CCTGCCAACCACAAGGAGGCTGG + Intergenic
1104896706 12:132168396-132168418 TCTGCAAGTCACAGTGAGGCCGG + Intergenic
1105274449 13:18906429-18906451 CATGCTGGCCACTGGGTGGCAGG - Intergenic
1107444515 13:40458315-40458337 CCTGGTAGGCACAAGGAGACTGG - Intergenic
1107661398 13:42643184-42643206 CCTGCTAGTGCCAGGGAGACTGG - Intergenic
1108144575 13:47463490-47463512 CCTGAGAGCCACAGGGAGCAGGG + Intergenic
1108957776 13:56182694-56182716 CCTGCTGGAGCCAGGGAGGCTGG + Intergenic
1109508636 13:63338404-63338426 CCTGCAAGTCACAGGATGGCAGG + Intergenic
1110011834 13:70345543-70345565 CATGCAACCCACAGGGTGGCAGG - Intergenic
1110790508 13:79582022-79582044 CCTGCTGGAGCCAGGGAGGCTGG - Intergenic
1114372779 14:22108970-22108992 CTTACTACCCAAAGGGAGGCAGG - Intergenic
1114528893 14:23382896-23382918 CCAGCTAGCCACAGGGCAGTGGG - Intronic
1114658434 14:24329872-24329894 CTGGCTAACCACATGGAGGCAGG - Exonic
1115928850 14:38467817-38467839 CCTGCTGGAGTCAGGGAGGCTGG - Intergenic
1116595750 14:46842318-46842340 TCTGCTAGCCACAGGAAAGCAGG + Intronic
1118436287 14:65773654-65773676 CCTGCTAGCAACATGGAAGAAGG - Intergenic
1118602444 14:67480397-67480419 CTCGGTAGCCACAGGGAAGCTGG - Intronic
1119103929 14:71906463-71906485 CCTCCTAGGCAAAGGGAGGTTGG - Intergenic
1119523901 14:75307094-75307116 CCTGCTCTCCACACGGTGGCAGG + Intergenic
1121217438 14:92259447-92259469 CCTCCCAGTCAGAGGGAGGCTGG - Intergenic
1121905707 14:97741104-97741126 CCTGCTGGAGCCAGGGAGGCTGG - Intergenic
1122075577 14:99232629-99232651 CCTGCAAGCCACCAGGAGCCAGG + Intronic
1122231435 14:100307969-100307991 CTTGGTTGCCTCAGGGAGGCAGG + Intergenic
1122261944 14:100528740-100528762 CCTGCCTGCCACAGGGACACAGG + Intronic
1122278001 14:100605105-100605127 CCTGGTCTCCACAGGGAGGAGGG + Intergenic
1122880073 14:104686832-104686854 TCTGCTAGAAACAGGCAGGCAGG - Intergenic
1202929598 14_KI270725v1_random:26219-26241 CATGCCAGCCACTGGGTGGCAGG - Intergenic
1123442304 15:20301345-20301367 CATGCCAGCCACTGGGTGGCAGG - Intergenic
1124196912 15:27639461-27639483 CCTGCCAGCACCAGGGAGACTGG + Intergenic
1126284599 15:46996648-46996670 CCTGCTGGAGCCAGGGAGGCTGG - Intergenic
1127871311 15:63076210-63076232 CCGGCTGGGCACAGGGGGGCCGG + Intergenic
1128556691 15:68636515-68636537 CCTGATAGCATGAGGGAGGCAGG + Intronic
1128737686 15:70062529-70062551 CCTGCCAGCCAGAGGCGGGCTGG - Intronic
1129778227 15:78251151-78251173 CCTGCTAGCTACATGTTGGCTGG - Intergenic
1129882897 15:79018822-79018844 CCTCCTAGGCCCAGGGAGGTGGG - Intronic
1132073747 15:98801826-98801848 GCTGCTAGCCACGGGGATGGGGG - Intronic
1133014001 16:2930573-2930595 CCTGCGGGCCACAGTGATGCGGG + Exonic
1136718913 16:32304205-32304227 CATGCTGGCCACTGGGTGGCAGG + Intergenic
1136723934 16:32342561-32342583 CATGCTGGCCACTGGGTGGCAGG + Intergenic
1136773003 16:32857753-32857775 CATGCTGGCCACTGGGTGGCAGG - Intergenic
1136837286 16:33510469-33510491 CATGCTGGCCACTGGGTGGCAGG + Intergenic
1136842262 16:33548605-33548627 CATGCTGGCCACTGGGTGGCAGG + Intergenic
1136862046 16:33710337-33710359 CATGCTGGCCACTGGGTGGCAGG - Intergenic
1136897612 16:34003766-34003788 CATGCTGGCCACTGGGTGGCAGG + Intergenic
1138536020 16:57660690-57660712 CCTGCTGGCCTCAGGGAGTCTGG - Intronic
1138609472 16:58111220-58111242 CATGCTAAGCACAGGGAAGCAGG + Intergenic
1138630822 16:58293142-58293164 CCTTCTAACCCCAGGGAGGCAGG + Intronic
1139289343 16:65843490-65843512 AGTGCTAGCTACAGGGTGGCTGG - Intergenic
1140127783 16:72132464-72132486 CTTCCTGGCCACAGGGAGGCAGG - Intronic
1140685259 16:77427457-77427479 TGTGCTAGTCAGAGGGAGGCTGG + Intronic
1141147893 16:81544510-81544532 CCTGAGAGCCACACAGAGGCCGG - Intronic
1141997709 16:87645799-87645821 CCTGCCAGCCACAGCTTGGCGGG - Intronic
1142105230 16:88299063-88299085 CCTGCAAGCCAATGGGGGGCAGG + Intergenic
1142249321 16:88983891-88983913 CCTGGGACCCCCAGGGAGGCTGG - Intergenic
1203002497 16_KI270728v1_random:175204-175226 CATGCTGGCCACTGGGTGGCAGG - Intergenic
1203007518 16_KI270728v1_random:213566-213588 CATGCTGGCCACTGGGTGGCAGG - Intergenic
1203075428 16_KI270728v1_random:1119863-1119885 CATGCTGGCCACTGGGTGGCAGG - Intergenic
1203123538 16_KI270728v1_random:1558520-1558542 CATGCTGGCCACTGGGTGGCAGG - Intergenic
1203134102 16_KI270728v1_random:1711610-1711632 CATGCTGGCCACTGGGTGGCAGG - Intergenic
1203147462 16_KI270728v1_random:1810748-1810770 CATGCTGGCCACTGGGTGGCAGG + Intergenic
1203152427 16_KI270728v1_random:1848902-1848924 CATGCTGGCCACTGGGTGGCAGG + Intergenic
1142496759 17:310121-310143 CCAGCTAGCCATGGGGAGGCTGG - Intronic
1142741419 17:1934020-1934042 CCTGCAGGCCACAGGGGAGCAGG + Intergenic
1143033361 17:3980531-3980553 CCTGCCAGGCCCAGCGAGGCTGG + Intergenic
1143329236 17:6121499-6121521 CCAGCTATCCTCAGGGAAGCTGG + Exonic
1143772715 17:9178799-9178821 CCGCCTAGCTTCAGGGAGGCAGG + Intronic
1143781064 17:9230020-9230042 CCAGCTAGCCTCAGGGACACGGG + Intronic
1143978711 17:10849422-10849444 TGTGCTAGAGACAGGGAGGCAGG - Intergenic
1144891961 17:18499451-18499473 ACTGCTGGCCTCAGGGAGGTGGG + Intergenic
1145810045 17:27759138-27759160 CCTGCTGGCCTCAAGGAGGCGGG + Intronic
1145875589 17:28316753-28316775 GCCGGCAGCCACAGGGAGGCAGG - Intergenic
1145956894 17:28860873-28860895 CCTGCTAGCAACAGCGACTCAGG - Exonic
1147243943 17:39108566-39108588 CCTCCTATCAACAGGGAGCCTGG + Intronic
1147263075 17:39219969-39219991 CCTGCTGGCCTCCCGGAGGCTGG - Intronic
1147509949 17:41059702-41059724 TCGGCTGGCCGCAGGGAGGCCGG + Exonic
1147705216 17:42421486-42421508 GCTCCTAACCCCAGGGAGGCGGG - Intronic
1147966177 17:44195409-44195431 CCTGCTAACCACGGTGAGGGAGG - Exonic
1147988921 17:44321688-44321710 CCGGCTACTCACAGGGTGGCGGG + Exonic
1148913103 17:50953866-50953888 CCTTCAAGCTCCAGGGAGGCAGG + Intergenic
1151188704 17:72382204-72382226 CCTATGAGCCTCAGGGAGGCTGG - Intergenic
1151337002 17:73445930-73445952 CCAGCTGGCCCCAGGGAGGTGGG - Intronic
1151339677 17:73462802-73462824 CCTGAGAGCCACAGTGAGGTGGG - Intronic
1152623901 17:81379706-81379728 CCTGCTGGTAAGAGGGAGGCAGG - Intergenic
1154107331 18:11534008-11534030 CATGCTGGCCACTGGGTGGCAGG - Intergenic
1154170301 18:12046569-12046591 CATGCTGGCCACTGGGTGGCAGG + Intergenic
1154485355 18:14867835-14867857 CATGCTGGCCACTGGGTGGCTGG - Intergenic
1154999759 18:21674844-21674866 CCTGATAGCCAGAGGGAGGAGGG - Intronic
1155587664 18:27386186-27386208 CCTGCTCACCACTGGCAGGCTGG + Intergenic
1155847788 18:30731232-30731254 CCTGCTGGAGCCAGGGAGGCTGG + Intergenic
1156694760 18:39753348-39753370 CCTGCCAGCTCCAGGGAGTCTGG + Intergenic
1157203490 18:45679170-45679192 CCTGCTAGGCAGAGGGAGCCAGG + Intronic
1158346493 18:56521551-56521573 CCTCTGAGCCACAGGGAGCCTGG + Intergenic
1158616024 18:58987803-58987825 CCACCTAGTCACAAGGAGGCTGG + Intergenic
1158729182 18:60003807-60003829 CCTGCTGGAGACAGGGAAGCTGG - Intergenic
1159065927 18:63567903-63567925 CCTTCTGGCCACGTGGAGGCTGG + Intergenic
1159065937 18:63567948-63567970 CCTTCTGGCCACGTGGAGGCTGG + Intergenic
1160041547 18:75350062-75350084 CCTGCCAGCCCGAGTGAGGCGGG - Intergenic
1160858159 19:1226631-1226653 CCTGCAAGCAGCAGTGAGGCTGG + Exonic
1160982502 19:1822815-1822837 CCAGCCAGCGCCAGGGAGGCAGG + Intronic
1162746185 19:12800066-12800088 GCTGCTAGCCACAGGGCTGGGGG + Intronic
1162777384 19:12988019-12988041 GCTGCTAGCCACAGCCAGGTGGG + Intergenic
1162810732 19:13163171-13163193 CCTGCCCGCCCCAGGGAGGCGGG + Intergenic
1163287148 19:16355899-16355921 CCTGCAAGCTGGAGGGAGGCAGG + Intronic
1163344834 19:16734072-16734094 CCTGCTCGCCATGGGGAGGCTGG - Intronic
1163872151 19:19830989-19831011 CCTGCTAGAGCCAGGGAGGCTGG + Intergenic
1163886144 19:19966426-19966448 CCTGCTAGAGCCAGGGAGGCTGG - Intergenic
1163888324 19:19989052-19989074 CCTGCTAGAGCCAGGGAGGCTGG + Intergenic
1163958440 19:20665166-20665188 CCTGCTAGAGCCAGGGAGGTTGG - Intronic
1163993612 19:21022301-21022323 ACTGCAAGCCAGAGTGAGGCTGG - Intronic
1163999455 19:21083495-21083517 ACTGCAAGCCAGAGTGAGGCTGG - Intronic
1164003476 19:21128447-21128469 ACTGCAAGCCACAGTGAGGCTGG + Intergenic
1164005329 19:21143053-21143075 ACTGCAAGCCAGAGGGAGGCTGG - Intronic
1164030385 19:21398127-21398149 ACTGCAAGCCAGAGTGAGGCCGG - Intronic
1164070753 19:21766248-21766270 ACTGCAAGCCAGAGTGAGGCTGG + Intronic
1164316015 19:24088505-24088527 CCTGCAAGCCAGAGTTAGGCTGG - Intronic
1166687455 19:44804126-44804148 GATGCTTGCCACAGGGCGGCTGG + Intergenic
1166978917 19:46621447-46621469 CCAGCTCGCCTCAGGGAGGAGGG - Exonic
1168330388 19:55564462-55564484 CCCGCTTGCCCCAGGGAGGCCGG + Intergenic
925114784 2:1369590-1369612 ACTGCCAGGAACAGGGAGGCTGG - Intergenic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925311011 2:2881603-2881625 CCTGTCAGCCACAGGGAAGCAGG + Intergenic
927163409 2:20292214-20292236 GGGGCCAGCCACAGGGAGGCGGG - Intronic
928757586 2:34545507-34545529 CCTGCTGGAGCCAGGGAGGCTGG - Intergenic
928803693 2:35125491-35125513 CCTGCTAGATCCAGGGAGACTGG + Intergenic
929589600 2:43136277-43136299 GCTGCTACCCACAGGGAGGAAGG + Intergenic
930545763 2:52765803-52765825 CCTGCTGGAGCCAGGGAGGCTGG + Intergenic
930724135 2:54666280-54666302 ACTGTTAACCACAGGGAAGCTGG - Intronic
932352829 2:71045900-71045922 CCTACTATCCAGAGGGAGGGAGG - Intergenic
932826725 2:74948013-74948035 CCTGCTGGAGCCAGGGAGGCTGG + Intergenic
933237593 2:79882548-79882570 CCTGCTGGAGCCAGGGAGGCTGG - Intronic
933602553 2:84347881-84347903 CCTGCTAGAGCCAGGGAGGCTGG - Intergenic
933616519 2:84487469-84487491 CCCCCTAGCCACATGGAGTCTGG + Intergenic
933652168 2:84858319-84858341 TCTGCTGGCCACAGGGTGGCAGG - Intronic
934322203 2:91980993-91981015 CATGCTGGCCACTGGGTGGCAGG - Intergenic
934460493 2:94211779-94211801 CATGCTGGCCACTGGGTGGCAGG - Intergenic
934663852 2:96157090-96157112 GGTGCTGGCCCCAGGGAGGCGGG - Intergenic
936849095 2:116874051-116874073 CCTGCTGGAGCCAGGGAGGCTGG - Intergenic
937092630 2:119216612-119216634 CCTGGTAGCCATAGGGAGAGTGG - Intergenic
937931497 2:127208661-127208683 CCTGCTGGAGCCAGGGAGGCTGG + Intronic
938287084 2:130127910-130127932 CATGCTGGCCACTGGGTGGCAGG + Intronic
938428509 2:131210960-131210982 CATGCTGGCCACTGGGTGGCAGG - Intronic
938469411 2:131544978-131545000 CATGCTGGCCACTGGGTGGCAGG - Intergenic
938736838 2:134193484-134193506 CCAGCTAGCCACTGGGTGGTGGG - Intronic
939808943 2:146808137-146808159 CCTGCTGGAGCCAGGGAGGCTGG + Intergenic
940273397 2:151915312-151915334 CCTGCTGGAGCCAGGGAGGCTGG - Intronic
940410721 2:153360525-153360547 CCTGCTGGAGCCAGGGAGGCTGG + Intergenic
941034338 2:160551379-160551401 CCTGCTAGCCACAGGGGATGTGG - Intergenic
941088565 2:161147165-161147187 CCTGCTGGAGCCAGGGAGGCTGG - Intronic
941694383 2:168535053-168535075 CCTGCTGGAGCCAGGGAGGCTGG - Intronic
942376104 2:175339639-175339661 CCTGCTGGAGCCAGGGAGGCTGG - Intergenic
943216530 2:185044398-185044420 CCTGCTGGAGCCAGGGAGGCTGG - Intergenic
944962481 2:204890718-204890740 CCTGCTAGCCACAGGGAGGCAGG + Intronic
946546444 2:220749392-220749414 CCTGCTAAAGCCAGGGAGGCTGG + Intergenic
947324710 2:228961662-228961684 CCTACTGGTCACAGGAAGGCTGG - Intronic
947697225 2:232201815-232201837 CCAGCTAGACACAGGAAGGGAGG + Intronic
947771674 2:232675401-232675423 CCTCTCAGCCTCAGGGAGGCTGG - Intronic
948270665 2:236670861-236670883 CCTCCTACCCACAGACAGGCTGG - Intergenic
1169075187 20:2755838-2755860 CCTTCCTGCCACAGTGAGGCAGG - Intronic
1169641896 20:7761471-7761493 CCTGCTAGGTACAGAGAGTCTGG - Intergenic
1170496593 20:16930943-16930965 CCTGCTGGAGCCAGGGAGGCTGG + Intergenic
1170822661 20:19767496-19767518 CTGGCTAGCCTCAGGGAGGATGG + Intergenic
1171226515 20:23446078-23446100 CCTGCTATCCTCTGGGAGTCTGG - Intergenic
1173091325 20:39974964-39974986 CCTGCTGGAGCCAGGGAGGCTGG - Intergenic
1173108180 20:40158244-40158266 CCTGCTATACTGAGGGAGGCAGG - Intergenic
1173225838 20:41161990-41162012 CCTGCTGCCCACTGGGATGCTGG - Intronic
1176013564 20:62914651-62914673 CAGGCTTGCCCCAGGGAGGCAGG + Intronic
1176591622 21:8654818-8654840 CATGCCAGCCACTGGGTGGCAGG - Intergenic
1176795979 21:13371641-13371663 CATGCTGGCCACTGGGTGGCTGG + Intergenic
1176857525 21:13984596-13984618 CATGCCAGCCACTGGGTGGCAGG - Intergenic
1176867081 21:14059626-14059648 CATGCCAGCCACTGGGTGGCAGG + Intergenic
1177511387 21:22091876-22091898 CCTGCTGGAGCCAGGGAGGCTGG - Intergenic
1177735188 21:25080356-25080378 CCTGAAAACCACAGGGAGCCTGG - Intergenic
1177867596 21:26531223-26531245 CATGCTCACCACAGGGAAGCTGG + Intronic
1177878944 21:26669424-26669446 CCTGCTGGAGCCAGGGAGGCTGG - Intergenic
1178241954 21:30912960-30912982 CTTAACAGCCACAGGGAGGCTGG + Intergenic
1178529784 21:33366181-33366203 CCTTCTTGCCACATGGAGACAGG + Intergenic
1180147339 21:45928757-45928779 CCTGCGACCCACAGCCAGGCAGG - Intronic
1180274470 22:10631930-10631952 CATGCCAGCCACTGGGTGGCAGG - Intergenic
1180548954 22:16526907-16526929 CATGCTGGCCACTGGGTGGCAGG - Intergenic
1180853358 22:19032385-19032407 CCAGCAGGGCACAGGGAGGCTGG - Intergenic
1181335650 22:22125889-22125911 CATGCTGGCCACTGGGTGGCAGG - Intergenic
1181355753 22:22294976-22294998 CATGCCAGCCACTGGGTGGCAGG + Intergenic
1182684057 22:32107160-32107182 CCTGCCTGCCCCAGGGAGGCAGG - Intronic
1182686416 22:32123826-32123848 CATGCTGGCCACTGGGTGGCAGG - Intergenic
1182696514 22:32202593-32202615 CATGCTGGCCACTGGGTGGCAGG + Intronic
1183250322 22:36725763-36725785 CCGGAGAGCCACAGGGAGCCCGG + Intergenic
1183567124 22:38623482-38623504 CCTGCTGGCTCCTGGGAGGCTGG + Intronic
1183872273 22:40748854-40748876 CCCGTTTGCCACTGGGAGGCAGG + Intergenic
1184094451 22:42309080-42309102 CCGGCCGGCCACAGAGAGGCTGG + Intronic
1184596401 22:45516744-45516766 CCTGCCAGCCTCGGGGAGCCGGG + Intronic
1184897499 22:47419505-47419527 CCTGCTACCCACAGCTAGGATGG - Intergenic
949119953 3:373458-373480 CCTGCTGGAGCCAGGGAGGCTGG - Intronic
949896645 3:8772173-8772195 GCTGGTAGCCACAGGGAAGATGG + Intronic
950095834 3:10329817-10329839 GCTGCATGCCACGGGGAGGCCGG + Intronic
950182842 3:10927266-10927288 CCTGCCTGGCAGAGGGAGGCAGG + Intronic
950379957 3:12604145-12604167 CCTGCTGTCCACAGGCAGGGTGG + Exonic
950647052 3:14383470-14383492 CCAGGGAGCCACTGGGAGGCTGG + Intergenic
952586426 3:34898410-34898432 CCTGCTAGACACTGGGAGTTGGG - Intergenic
952634002 3:35505405-35505427 CCTGCTGGAGCCAGGGAGGCTGG + Intergenic
952966273 3:38623021-38623043 CCTGCTACCCCTGGGGAGGCAGG + Intronic
953784941 3:45904349-45904371 CCTGCTATCTACAGGCAGCCTGG + Intronic
953982253 3:47418706-47418728 CCTGCTGGGCACTGGGAAGCAGG - Exonic
954746333 3:52789592-52789614 CCTGCTAAGCAAAGGCAGGCAGG + Intronic
955003854 3:54951598-54951620 CCTGGGAGCCACAGGGCGGCTGG + Intronic
955832133 3:63015700-63015722 CCTGCTGGAGCCAGGGAGGCTGG - Intergenic
956046402 3:65200536-65200558 GCTGCCAGCCACTGGGAGCCTGG + Intergenic
957291334 3:78281587-78281609 CCTGCTGGAGCCAGGGAGGCTGG + Intergenic
957584351 3:82114717-82114739 CCTGCTAGAGCCAGGGAAGCTGG - Intergenic
957630093 3:82707237-82707259 CCTGCTGGAGCCAGGGAGGCTGG - Intergenic
958656494 3:97009447-97009469 CCTGCCAGAGCCAGGGAGGCTGG - Intronic
958932370 3:100221351-100221373 CAGGCTAACCACAGGGAGTCAGG - Intergenic
958955958 3:100466359-100466381 CCTGAGAGCAACAGGGGGGCAGG - Intergenic
959031101 3:101300238-101300260 CCTGCTGGAGCCAGGGAGGCTGG - Intronic
959742970 3:109742333-109742355 GCAGCAAGGCACAGGGAGGCTGG - Intergenic
960090183 3:113630827-113630849 CCTGAATCCCACAGGGAGGCAGG + Intergenic
960233435 3:115254930-115254952 CCTGCTGGAGCCAGGGAGGCTGG + Intergenic
960614054 3:119580751-119580773 CCTGAAAGCCACAGGGAGAAGGG + Intronic
961648857 3:128407559-128407581 CCTGCCTGCCAAAGGGAGCCAGG + Intronic
961829118 3:129614361-129614383 CTTGGAAGCCTCAGGGAGGCCGG + Intergenic
963461255 3:145617322-145617344 CCTGCTGGAGCCAGGGAGGCTGG - Intergenic
964157377 3:153602577-153602599 CCAGCAAGCCACAAGGAAGCTGG + Intergenic
964624602 3:158747219-158747241 CCTTCCAGTCACAGGGAGACAGG + Intronic
965263325 3:166510758-166510780 CCTGCTGGAGTCAGGGAGGCTGG + Intergenic
965288877 3:166850110-166850132 CCTGGGAGCCACAGGGAGCAAGG - Intergenic
966152040 3:176875782-176875804 CCTGTGAGCCACATGGAGCCAGG - Intergenic
966539641 3:181075197-181075219 CCTGCTGGAGCCAGGGAGGCTGG - Intergenic
967258868 3:187622106-187622128 GCTGCTAGCCATGGGAAGGCTGG + Intergenic
967989553 3:195120952-195120974 CCTGTGAGCCCCAGGGAGGTAGG - Intronic
968578925 4:1380694-1380716 CCTGAGAGCCACAGGGACGTGGG - Intronic
968733907 4:2285408-2285430 CCTGGCAGCCACAGTGGGGCCGG - Intronic
968755921 4:2416747-2416769 GCTGCTAGGGACAGGGAGGTTGG + Intronic
968808329 4:2788859-2788881 CCTCCTATCCCCAGGGAAGCAGG + Intergenic
970494288 4:16609510-16609532 CCTGCTGGAGCCAGGGAGGCTGG + Intronic
971041293 4:22755015-22755037 GCTGCTAGCCACAAGGGGCCAGG + Intergenic
971853163 4:32010347-32010369 CCTGCTGGAGCCAGGGAGGCTGG + Intergenic
973584660 4:52377863-52377885 CCTGCTGGAGCCAGGGAGGCTGG + Intergenic
976538220 4:86242683-86242705 CCTGCTAGAGCCAGGGAGGCTGG - Intronic
976807436 4:89063613-89063635 CCTGCTAGGGCCAGGGAGGCTGG - Intronic
977222505 4:94354563-94354585 CCTGAGAGGCACAGTGAGGCTGG + Intergenic
977269056 4:94892227-94892249 CTTGCTACCCACAGGGTGGTTGG + Intronic
979775427 4:124583369-124583391 CCTGCTGGAGCCAGGGAGGCTGG + Intergenic
980184643 4:129446397-129446419 CCTGCTGGAGCCAGGGAGGCTGG + Intergenic
980878509 4:138686261-138686283 CCTGGAAGGCACAGGGAGGACGG + Intergenic
982274047 4:153621828-153621850 CCTGCTGCCCAGAGAGAGGCAGG + Exonic
982971963 4:162000142-162000164 CCTGCTAGCCACAAAGACACAGG + Intronic
984335000 4:178379261-178379283 CCTGCTGGAGCCAGGGAGGCTGG + Intergenic
984626121 4:182009563-182009585 CCTGCTGGAGCCAGGGAGGCTGG - Intergenic
985200444 4:187479140-187479162 TCTGAGAGCCACAGGGAAGCTGG - Intergenic
985333681 4:188868965-188868987 CCTGGCAGCCACAGAGAGGTTGG - Intergenic
985416464 4:189740839-189740861 CCTGCTAGCAACAGGAGGGTCGG - Intergenic
986140649 5:5026536-5026558 CCTGCTGGCACCAGGGAGGCTGG + Intergenic
986376651 5:7138949-7138971 CCTGATGACCACAGAGAGGCTGG - Intergenic
986800613 5:11256347-11256369 CTTGGTTGCCACAGAGAGGCTGG - Intronic
987988584 5:25181277-25181299 CCTGCTGGAGCCAGGGAGGCTGG - Intergenic
989418245 5:41205646-41205668 ACTGCAAGGCACAGGGAGGCTGG + Intronic
990139094 5:52682522-52682544 CCTGCTGGAGCCAGGGAGGCTGG - Intergenic
991120560 5:63008438-63008460 CCGGCCAGCCACAGGGAGTGTGG - Intergenic
991221696 5:64225780-64225802 CCTCCCAGCCAAAGGGAGGCTGG - Intronic
991997963 5:72406952-72406974 CCAGGTAGCCACAGTGATGCTGG - Intergenic
992157479 5:73969425-73969447 CCTGTTTGCCCCAGGGAGGGAGG + Intergenic
994096063 5:95849176-95849198 CTTGCTAGCCACAGGAATACAGG - Intergenic
994696634 5:103079877-103079899 CCTGCTGGATCCAGGGAGGCTGG - Intergenic
995084051 5:108086983-108087005 CTTGCTACCAACAGAGAGGCCGG + Intronic
995380954 5:111532673-111532695 ACAGTTAGCCAGAGGGAGGCTGG - Intergenic
996535464 5:124572621-124572643 AGTGCTAGCTACTGGGAGGCTGG - Intergenic
997177760 5:131796919-131796941 CATGCTAGCCACGGCCAGGCAGG + Exonic
998038783 5:138937755-138937777 GCTGCTAGCCACAGGAGAGCAGG - Intergenic
1001696609 5:173674928-173674950 CCTGCTAGCCAGAAGGAAGGGGG - Intergenic
1001772175 5:174304854-174304876 CCTGCTAGGCACAGTGAGCAAGG + Intergenic
1001852277 5:174979991-174980013 GCTGTGAGCCACAGGGAGGGTGG + Intergenic
1002102512 5:176864397-176864419 CGTGCTGGGCACAGGGAGACTGG + Intronic
1002439304 5:179256096-179256118 CCTTCTTCCCACAGGGAGACCGG + Intronic
1002724130 5:181283274-181283296 CATGCTGGCCACTGGGTGGCAGG - Intergenic
1002905026 6:1441298-1441320 CTTGCTATCCACAGGGAGGTTGG + Intergenic
1002905040 6:1441396-1441418 CTTGCTATCCACAGGGAGGTTGG + Intergenic
1002905054 6:1441494-1441516 CTTGCTATCCACAGGGAGGTTGG + Intergenic
1002905068 6:1441592-1441614 CTTGCTACCCACAGGGAGGTTGG + Intergenic
1003441405 6:6146015-6146037 CCTGATGGCCACTGGGAGGCTGG - Intronic
1004425183 6:15502286-15502308 CCCGCTACCCACTGGCAGGCTGG - Intronic
1004518285 6:16339213-16339235 CCTGCCAGCCACCAGGGGGCTGG + Intronic
1005121050 6:22389811-22389833 CCTGCTGGAGCCAGGGAGGCTGG - Intergenic
1005170604 6:22980607-22980629 CCTGCTAGAACCAGGGAGTCTGG + Intergenic
1006026481 6:31150373-31150395 CCTCCTGCCCACAGGGAGGGAGG + Intronic
1007418059 6:41703489-41703511 CAGACCAGCCACAGGGAGGCTGG - Intronic
1007718795 6:43873030-43873052 GCTGCTAGGCAAAGGGATGCTGG + Intergenic
1008298414 6:49805482-49805504 CCTGCCAGCTCCAGGGAGTCTGG + Intergenic
1008434340 6:51457448-51457470 GCTGCTTTCCAGAGGGAGGCTGG + Intergenic
1008725426 6:54411927-54411949 CCTACTAGCTACAGTGAGTCTGG + Intergenic
1009902105 6:69820222-69820244 GCTTCTAGCCACAGAGAGCCAGG - Intergenic
1010331274 6:74626612-74626634 CCTGCTAGAGCCAGGGAGGCTGG + Intergenic
1010483221 6:76379305-76379327 CCTGCTGGAGCCAGGGAGGCTGG - Intergenic
1010718980 6:79261721-79261743 CCTGCTGGAGGCAGGGAGGCTGG - Intergenic
1010945605 6:81970200-81970222 CCTGCTGGAGCCAGGGAGGCTGG + Intergenic
1012356038 6:98315754-98315776 GCTGCTAGCCACAGAGGGTCTGG + Intergenic
1014369288 6:120584450-120584472 CCTGCTGGAGACAGGGAAGCTGG - Intergenic
1015136946 6:129882914-129882936 CCTGAGAGCCACAGTGGGGCAGG - Intergenic
1015660191 6:135566412-135566434 CCTGCTGGAGCCAGGGAGGCTGG - Intergenic
1017581910 6:155874380-155874402 CCTGCTACCCGGAAGGAGGCTGG + Intergenic
1018606008 6:165598836-165598858 CTTGCCAGCCGCTGGGAGGCTGG + Intronic
1018696557 6:166395908-166395930 CCTAGTAGCCTCAGGGAGGGAGG + Intergenic
1019352568 7:561874-561896 CCTGCATGCCAGAGTGAGGCAGG + Intronic
1019666653 7:2255247-2255269 CCTGCCAGTGACAGGGAGGGAGG + Intronic
1019742562 7:2682140-2682162 CAGGCTGGGCACAGGGAGGCTGG + Intronic
1020633798 7:10672236-10672258 CCTGCTGGGGCCAGGGAGGCTGG - Intergenic
1022634626 7:32120046-32120068 CCTGCTAGAGCCAGGGAGGCTGG + Intronic
1023327471 7:39075645-39075667 CCTGAAGGCCACAGGGAGGCTGG + Intronic
1023854310 7:44172537-44172559 CCAGCTAGCCAGAGGCAGGATGG - Intronic
1024271958 7:47649395-47649417 AGTCCTAGCTACAGGGAGGCAGG + Intergenic
1027943955 7:84722541-84722563 CCTGAGAGCCACAGGGAGAAGGG + Intergenic
1028517974 7:91698874-91698896 CCTGCTGGAGCCAGGGAGGCTGG + Intronic
1029212015 7:98916882-98916904 CCTGCACGGCACAGGAAGGCAGG - Intronic
1030701577 7:112646933-112646955 CCTGCTGGAGCCAGGGAGGCTGG - Intergenic
1031804575 7:126292656-126292678 CCTGCTGGAGCCAGGGAGGCTGG + Intergenic
1031970594 7:128062271-128062293 TCTGCTTGGCACATGGAGGCAGG + Intronic
1032262724 7:130350003-130350025 TCTCATATCCACAGGGAGGCTGG - Exonic
1033146126 7:138871268-138871290 CCGGCTAGCCTCCGGGGGGCGGG + Exonic
1033879400 7:145862548-145862570 CCTGCTGGAGCCAGGGAGGCTGG + Intergenic
1034990206 7:155543178-155543200 CCGGCTGGCCACAGAGCGGCAGG - Intergenic
1035272694 7:157729799-157729821 CCTGCTGGCCACGTGGAGGACGG + Intronic
1035294897 7:157861477-157861499 CCTGCAAGACTCAGGGAGGGCGG - Intronic
1035459017 7:159028021-159028043 CCTGCCAGCCACAGGGCACCAGG - Intergenic
1035547244 8:492458-492480 CCTGCGCGCGGCAGGGAGGCTGG - Exonic
1035744479 8:1951911-1951933 CCTTGTAGCCACCGTGAGGCGGG + Intronic
1036833030 8:12036786-12036808 CCTAATATCCACAGGGAGACAGG + Intergenic
1037581644 8:20249149-20249171 CCGGCAAGCCACAGGAAGGAGGG - Exonic
1037703608 8:21296877-21296899 CGCTCTGGCCACAGGGAGGCAGG + Intergenic
1039293853 8:36127777-36127799 CCTGCTGGAGCCAGGGAGGCTGG - Intergenic
1039486756 8:37916193-37916215 TCTGCTGGCCCCAGGGAGGAGGG - Intergenic
1041202787 8:55467102-55467124 TCTGCCAGCCACAGGGAGCTTGG - Intronic
1041259883 8:56012224-56012246 CCTGTCTGTCACAGGGAGGCTGG - Intergenic
1041355884 8:56999677-56999699 TCTGCTAGCCACATGGATGCTGG - Intergenic
1041397598 8:57407387-57407409 ACACCTAGCCACAAGGAGGCTGG - Intergenic
1041472113 8:58222493-58222515 TCTGCTAGCCACAGGGAATTTGG - Intergenic
1042207679 8:66345451-66345473 TCTGCCAGCCACACGGAGGAAGG + Intergenic
1044356159 8:91225019-91225041 CCTGCTGGGGCCAGGGAGGCTGG - Intronic
1045823752 8:106372265-106372287 CCTGAGAGCCACAGGGAGATGGG - Intronic
1047812084 8:128421800-128421822 TTTTCTAGCCACAGGGAGCCAGG - Intergenic
1047927468 8:129695594-129695616 CATGCTGACCACAGGGAGGTGGG - Intergenic
1048440454 8:134455717-134455739 CCTTGTAGCAACAGGGTGGCTGG - Intergenic
1048854145 8:138672494-138672516 CCTTCTAGCCTAAGAGAGGCAGG - Intronic
1048863172 8:138738910-138738932 CCTGGGAGCAACAGGGAGGATGG + Intronic
1048870575 8:138793813-138793835 CCTGCAGCCCACAGGGAGGAAGG + Intronic
1049624034 8:143612157-143612179 CCTGAGAGCCACAGAGAGGAGGG + Intergenic
1049671479 8:143872041-143872063 CCAGCTGGCCACAGGCGGGCTGG - Exonic
1050450993 9:5781001-5781023 CCTGAAAGCCACAGGGAGAATGG + Intronic
1050630090 9:7549543-7549565 CCTGCTGGAGCCAGGGAGGCTGG + Intergenic
1052546636 9:29888900-29888922 CCTGCTGGAGCCAGGGAGGCTGG + Intergenic
1053886271 9:42646708-42646730 CATGCTGGCCACTGGGTGGCTGG - Intergenic
1054225291 9:62454157-62454179 CATGCTGGCCACTGGGTGGCTGG - Intergenic
1055112604 9:72574615-72574637 CCTGCTAACCACAGGAAGCTGGG + Intronic
1055343347 9:75308809-75308831 CCTGCTGGCTCCAGGGAGTCTGG - Intergenic
1055818853 9:80238373-80238395 CCTGCTGGAGCCAGGGAGGCTGG + Intergenic
1056574672 9:87846526-87846548 CCTGTCACCCACAGGGAGGGAGG - Intergenic
1057305691 9:93910821-93910843 CAGGCTGGCCACAGGGTGGCAGG + Intergenic
1057309792 9:93934953-93934975 ACTGCTAGCCACAGGGATTTGGG - Intergenic
1057931442 9:99196943-99196965 ACCGCTAGCCACAGGGAGACTGG + Intergenic
1061394112 9:130333927-130333949 CCTTGGAGCCACAGGCAGGCAGG + Intronic
1062029012 9:134353651-134353673 CCTGCTTTCCCCAGGGTGGCAGG + Intronic
1062161709 9:135083956-135083978 GCTGCCAGGCACAGGGAGCCGGG + Intronic
1062466170 9:136682562-136682584 CCTGCTGGCCACTGCCAGGCGGG + Intronic
1062574809 9:137201059-137201081 CCGGCTACCCCCAGGGACGCCGG - Intronic
1203621647 Un_KI270749v1:133582-133604 CATGCCAGCCACTGGGTGGCAGG - Intergenic
1186430921 X:9503583-9503605 CCTGCTAGAGCCAGGGAGGCTGG + Intronic
1187823989 X:23316767-23316789 ACTGCTAGGGACAGTGAGGCAGG - Intergenic
1188092148 X:25977063-25977085 CCTGCTGGAGCCAGGGAGGCTGG + Intergenic
1188884325 X:35531360-35531382 CCTGCTAGAGCCAGGGAGGCTGG + Intergenic
1189571870 X:42306771-42306793 CCTGCTGGAGTCAGGGAGGCTGG + Intergenic
1190244680 X:48683536-48683558 GCTGCCAGCCAGAGGGAGGAGGG + Intronic
1190529596 X:51361587-51361609 CCTGCTGGAGCCAGGGAGGCTGG + Intergenic
1192018127 X:67354255-67354277 GGTGAAAGCCACAGGGAGGCTGG - Intergenic
1192716434 X:73647518-73647540 CCTGCTGGAGCCAGGGAGGCTGG + Intronic
1193048378 X:77076977-77076999 CCTGCTAGAGCCAGGGAGGCTGG - Intergenic
1193719524 X:84971502-84971524 CCTGCTGGAGCCAGGGAGGCTGG - Intergenic
1193739903 X:85204204-85204226 CCTGGGAGCAACAGGGAGCCAGG - Intergenic
1193768544 X:85561261-85561283 CCTGCTGGAACCAGGGAGGCTGG - Intergenic
1194058208 X:89163819-89163841 CCTGCTGGAGCCAGGGAGGCTGG - Intergenic
1194177210 X:90665358-90665380 CCTGCTGGTAACAGGGAGACTGG + Intergenic
1194286770 X:92020350-92020372 CCTGCTGGAGCCAGGGAGGCTGG + Intronic
1195275394 X:103276124-103276146 CCTGCAAGGCAGCGGGAGGCGGG - Intronic
1195983112 X:110601058-110601080 CTTGCTGGAGACAGGGAGGCTGG + Intergenic
1196517282 X:116628610-116628632 CCTGCTGGAGCCAGGGAGGCTGG - Intergenic
1196607364 X:117671828-117671850 CCTGCTGGAGCCAGGGAGGCTGG - Intergenic
1197049571 X:122042521-122042543 CCTGCTAGAGCCAAGGAGGCTGG - Intergenic
1198420874 X:136470003-136470025 CCTGCTAGCAAGAGGGACCCTGG + Intergenic
1199310830 X:146317874-146317896 CCTGCTGGTCCCAGGGAGACTGG + Intergenic
1199692477 X:150319290-150319312 CCAACTAGGCCCAGGGAGGCTGG - Intergenic
1200523881 Y:4247504-4247526 CCTGCTGGTAACAGGGAGACTGG + Intergenic
1200604316 Y:5244910-5244932 CCTGCTGGAGCCAGGGAGGCTGG + Intronic
1200742025 Y:6864279-6864301 CCTGCTGGAGCCAGGGAGGCTGG - Intergenic
1202070320 Y:20985460-20985482 CCTGATGGAGACAGGGAGGCTGG - Intergenic