ID: 944962777

View in Genome Browser
Species Human (GRCh38)
Location 2:204894490-204894512
Sequence CTGTTAATAATGAGGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 6, 3: 32, 4: 272}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944962777 Original CRISPR CTGTTAATAATGAGGAAGCT GGG (reversed) Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
901585014 1:10282903-10282925 CTGTTAATAAAGATGAAGTTTGG + Intronic
902353521 1:15878043-15878065 TTATTAAAAATGAGAAAGCTTGG - Intronic
904530996 1:31169092-31169114 CAGTTAAGACTTAGGAAGCTGGG - Intergenic
906256327 1:44353726-44353748 CTGTAAATAATCAGCTAGCTAGG - Intronic
906709491 1:47918650-47918672 CAGATAATAATCAGGAAGCCTGG + Intronic
908177382 1:61569230-61569252 CTGTTAACAAGGAGGAAAGTCGG + Intergenic
908314721 1:62921480-62921502 ATGTTAATAATGGGGAAACTGGG - Intergenic
908552133 1:65219665-65219687 ATGCTAATAATGAAGAAGCTAGG - Intronic
911427977 1:97745483-97745505 ATGATAATAACCAGGAAGCTGGG + Intronic
911545828 1:99215254-99215276 TAGTTTAGAATGAGGAAGCTGGG - Intergenic
912650452 1:111434023-111434045 CACTTAACTATGAGGAAGCTGGG + Intergenic
913533692 1:119751240-119751262 CTGTTAGGAAACAGGAAGCTGGG - Intronic
915781813 1:158560431-158560453 ATGATAATAATGATGGAGCTTGG + Intergenic
916256922 1:162798184-162798206 ATGTTAATAATGGGGAAACTGGG - Intronic
916600022 1:166283628-166283650 TTGTTAAAAATGTGGAATCTTGG + Intergenic
916848976 1:168683790-168683812 CTGTTAGTTCTGAGGAATCTGGG - Intergenic
916958832 1:169868635-169868657 CTTCTAATAGTGAAGAAGCTAGG - Intronic
917245713 1:172998091-172998113 TTGTTAATAATGTGGATGCTTGG - Intergenic
918399760 1:184151886-184151908 GTGTAAAGGATGAGGAAGCTGGG - Intergenic
921194552 1:212742242-212742264 CTACTTATAATGAGTAAGCTTGG + Intronic
921195449 1:212752697-212752719 CTCTTAAAAATGTGGAAGTTAGG + Intronic
921228019 1:213039877-213039899 TTGTTAAGAATGAGTAAGTTAGG - Intergenic
921285781 1:213608099-213608121 CTGTTAAAAATGAAGACTCTTGG + Intergenic
921290497 1:213652429-213652451 CAGTTAACAATGTGGATGCTGGG - Intergenic
921771128 1:219041156-219041178 TTGTTAAGAATGAGGAAATTAGG + Intergenic
921800187 1:219393637-219393659 CTGTTAATAATGAGTAAACTGGG + Intergenic
924506683 1:244692589-244692611 CTGCTAAGAATCAGAAAGCTGGG - Intronic
1063136106 10:3217845-3217867 CTGTCAATAATAAGGAAAATTGG - Intergenic
1066318206 10:34270618-34270640 GTATTAATAATGAGTAAGATAGG - Intronic
1066424647 10:35295525-35295547 CTGTTTGTAATGATGAGGCTGGG - Intronic
1067810792 10:49425815-49425837 CTGTTTCTCATGTGGAAGCTTGG + Intergenic
1068127837 10:52863751-52863773 CTATTCACAATGAGGAAGATAGG - Intergenic
1068189342 10:53630044-53630066 TTCTCAATAATGAGGAAACTAGG - Intergenic
1068571103 10:58630248-58630270 CTGTTGATCATGGGAAAGCTGGG + Intronic
1068726945 10:60313690-60313712 CTGTAAATATTGAGGATGTTAGG - Intronic
1068779051 10:60899892-60899914 CTGTTGAAAATGAGGTGGCTAGG + Intronic
1069366412 10:67698880-67698902 CTGCTAATAATAAGGATGGTTGG - Intergenic
1069869908 10:71526795-71526817 CTTTTAAAAATGAGGAAGCTGGG + Intronic
1071729091 10:88230178-88230200 CTGTTAGAAATGAGGAAGGGAGG + Intergenic
1072474151 10:95742932-95742954 ATGTTAATAATCAGGGAACTGGG - Intronic
1073323564 10:102629840-102629862 CTGTCAATAATGAGGCAGGTTGG - Intronic
1074208736 10:111308397-111308419 CTTTTACTAATAAGGAAACTGGG - Intergenic
1074461197 10:113638513-113638535 ATTTTAATAATCAGGAAGTTTGG - Intronic
1074572929 10:114641125-114641147 CTTTTAATAATATCGAAGCTGGG + Intronic
1074575927 10:114669203-114669225 CTGTCTTTAATGAGGATGCTAGG - Intronic
1074804923 10:117039552-117039574 ATGTTAAAAATGGGGAATCTCGG + Intronic
1074975680 10:118579600-118579622 CTGTTAAGAATAAAGTAGCTGGG - Intergenic
1078043450 11:7890969-7890991 CTGGGAATAATTAGGAAACTTGG - Intergenic
1079693098 11:23444306-23444328 ATGTTAATAGTGAGGAGCCTGGG + Intergenic
1080562249 11:33474637-33474659 CTTTTACAAATGAGGAAGTTAGG - Intergenic
1081380494 11:42408713-42408735 CTGTTAATAATAATGAAGACTGG - Intergenic
1081532841 11:43975241-43975263 CTGTTAAGTATGAAGAAGCAGGG + Intergenic
1082061080 11:47860635-47860657 CTGTTAACAATAGGGGAGCTGGG - Intergenic
1083337367 11:61931501-61931523 CTCTTAATAATGAGCAATCAAGG + Intergenic
1084112958 11:67025155-67025177 CTTTTATAGATGAGGAAGCTGGG - Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085129674 11:74027406-74027428 CTATTTAAAATGAGGAAACTAGG - Intronic
1086140687 11:83495578-83495600 CTGCTATTAAAGAGGAAGATTGG + Intronic
1090225325 11:125068230-125068252 CTTTTATTGATGAGGAAACTGGG - Intronic
1090452805 11:126821503-126821525 CTTTTATAAATGAGGGAGCTGGG - Intronic
1090475328 11:127015006-127015028 CTGTTAGTAAGGATGAAGCTGGG - Intergenic
1090931555 11:131302076-131302098 TTGCTAATAATGATGGAGCTGGG - Intergenic
1091188348 11:133667433-133667455 CTGACAGTAATTAGGAAGCTGGG - Intergenic
1093251199 12:16806340-16806362 CTGGAAAAAATGAGGAAACTGGG + Intergenic
1093497360 12:19773704-19773726 ATGTTTATAATGAGGAAATTTGG - Intergenic
1094149023 12:27261526-27261548 CTGAAAATAATGGGAAAGCTTGG - Intronic
1094454351 12:30615807-30615829 TTGTTCATAATGAGCAAGCTAGG - Intergenic
1096607524 12:52777284-52777306 CTGTTCATAGTGAGAGAGCTTGG + Exonic
1096649559 12:53055294-53055316 CTATTAATAACGAGGAAGCTGGG - Intronic
1096905662 12:54932944-54932966 CTGGTAATAATGAGACAGCCAGG - Intergenic
1098904708 12:76150231-76150253 ATGTTAACAATGGGGAAGCTGGG - Intergenic
1099482094 12:83180628-83180650 ATTTTAAAAATGAGGAAACTGGG + Intergenic
1100612150 12:96200298-96200320 CTCTTAAGACTGATGAAGCTAGG + Intronic
1102032483 12:109750154-109750176 CTACTAATAATAAGGAAGGTTGG + Intronic
1102574568 12:113848078-113848100 CTTTTACATATGAGGAAGCTCGG - Intronic
1105388201 13:19951742-19951764 CTGTTAATGATGTGGAAGAAAGG + Intergenic
1105707023 13:22974134-22974156 CTGTTATTAAATAGGAAGCCAGG + Intergenic
1105936744 13:25107488-25107510 CTGTTTAGAACGAGGAAGCGGGG + Intergenic
1105944432 13:25177377-25177399 CTGTTGTTAATGAGGAGGCCAGG + Intergenic
1106690333 13:32108334-32108356 GTGTTGATGATGAGGAAGATAGG + Intronic
1106740285 13:32633717-32633739 ATATTAATAATGAGTAAACTGGG - Intronic
1106749195 13:32741298-32741320 AGGGTAATAATGAGAAAGCTGGG + Intronic
1106867111 13:33977276-33977298 ATGTTAATAATGAGGAAAATCGG + Intergenic
1107785216 13:43948972-43948994 ATGTTAATAATCAGAAAACTGGG + Intergenic
1108977723 13:56469702-56469724 CTACTAATAATGAGTAATCTTGG + Intergenic
1109335388 13:60987379-60987401 TTGTTAATAATGATCAAACTGGG - Intergenic
1110023327 13:70503906-70503928 ATGTGAATATTGGGGAAGCTGGG + Intergenic
1110701109 13:78550200-78550222 CTGTTGATAATGGGGGAGATTGG + Intergenic
1110846642 13:80197313-80197335 CTGTTACTAATAAGGAAAATAGG - Intergenic
1110959469 13:81603194-81603216 CTGAAAATAATGTGGAATCTAGG - Intergenic
1111181312 13:84669794-84669816 CTTTCATTAATGAGGAAACTAGG + Intergenic
1111729972 13:92062057-92062079 CTTTTAAAAATAAGAAAGCTTGG - Intronic
1111864618 13:93753133-93753155 GTGTCAATCATGAGGAAGCTGGG - Intronic
1112185520 13:97124577-97124599 CTATTAATCATGAGGGAGATTGG + Intergenic
1116629750 14:47314985-47315007 ATGTTAACAATGATGATGCTTGG + Intronic
1117379065 14:55142115-55142137 TGGTTAATTATGAGGAAGCCAGG + Intronic
1117884452 14:60345141-60345163 CTGTTAAAAGTGAGGAAGTCTGG + Intergenic
1117993833 14:61460211-61460233 CCATTAAAAATGAGGCAGCTTGG - Intronic
1118979223 14:70702486-70702508 GTGTTAATGTTGAGGAAACTAGG - Intergenic
1118985001 14:70746578-70746600 CAGTTAATGATGGTGAAGCTGGG - Intronic
1119098343 14:71855327-71855349 ATGTTGATAATGATGAATCTGGG + Intergenic
1120536213 14:85699031-85699053 ATGTTAATAATGGGGAAATTGGG + Intergenic
1120757413 14:88257208-88257230 CTTTTAGCAATGAGGAAGTTGGG - Intronic
1121472340 14:94165377-94165399 CTGTTGCTAATGAAGCAGCTCGG + Intronic
1121535662 14:94689076-94689098 CTATTAAGAATGAAGACGCTGGG + Intergenic
1121565013 14:94902817-94902839 ATGTTATTGATAAGGAAGCTGGG + Intergenic
1122567016 14:102666401-102666423 ATGTTAATAACGGGGAAACTGGG - Intronic
1124345197 15:28917591-28917613 ATGTTAATAATGAGGAAACAGGG - Intronic
1124639713 15:31390045-31390067 CTGTTAATAAAAAGGAAGCAAGG - Intronic
1126214574 15:46140047-46140069 CTGTTATTAGTCTGGAAGCTAGG - Intergenic
1126243902 15:46480526-46480548 ATGTTAACAATGGGGAAACTGGG - Intergenic
1126284547 15:46996384-46996406 CTGGTAGTAATGAGGAATCTGGG - Intergenic
1126515703 15:49534782-49534804 AAGTTAATAATGAGGAATGTGGG + Intronic
1128192914 15:65720732-65720754 CAGTTAACAAGGATGAAGCTGGG - Intronic
1128565496 15:68698209-68698231 CTGTCTGTGATGAGGAAGCTTGG - Intronic
1129012592 15:72435878-72435900 ACATTAACAATGAGGAAGCTGGG - Intergenic
1129191669 15:73941276-73941298 CTTGGAATGATGAGGAAGCTTGG - Intronic
1129763058 15:78142811-78142833 CTGTTAATAAACAGGAGGCATGG - Intronic
1132067652 15:98745387-98745409 CTGTTACAGGTGAGGAAGCTGGG + Intronic
1133556493 16:6910898-6910920 CTGTTAGTAAAGAGGAAGGAGGG + Intronic
1134324722 16:13196689-13196711 ATGTTAATAATAGGGAAACTGGG + Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135780562 16:25296287-25296309 CTATTAGTAATAAGGAAACTAGG - Intergenic
1136576084 16:31126239-31126261 CTGATAGCAATGAGGAGGCTGGG + Intronic
1138073684 16:54019334-54019356 CTGTTAACAAGGAAGAAGGTGGG + Intronic
1138587609 16:57981078-57981100 CTGTTAATAATCTGGTATCTTGG + Intronic
1140132678 16:72177588-72177610 ATGTTAATATTGGGGAAACTGGG - Intergenic
1140715354 16:77721472-77721494 CTGTTAAAAATGTGGACTCTGGG - Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1142795020 17:2300976-2300998 CTGACAATAATGAGGTAGTTTGG - Intronic
1143815726 17:9512733-9512755 CTGTTAAAAATGAGTAGGCTTGG - Intronic
1147442393 17:40455198-40455220 ATGTTAATAATGAGGAAACTGGG - Intronic
1147470618 17:40656650-40656672 CTTTTAATAATGAAGAAGTATGG + Intronic
1148023165 17:44566999-44567021 ATGTTGATAATGGGGAAGGTAGG - Intergenic
1150243110 17:63651575-63651597 ATGTTAGTAATGTTGAAGCTGGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1153113473 18:1623216-1623238 CTGTCAGTAATGGGGAAACTGGG + Intergenic
1154170903 18:12049203-12049225 CTGTTTAAAATGAGGCAGTTTGG - Intergenic
1154203549 18:12317954-12317976 CTATAAATATTGAGGAAGCTGGG + Intronic
1155195242 18:23468072-23468094 CTGATAAAGATGAGGAAGCCCGG - Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155399686 18:25424477-25424499 TTGTTAAGAATGAAGATGCTTGG - Intergenic
1156778524 18:40822207-40822229 CTGGTAATTCTGAGGAATCTAGG + Intergenic
1156884207 18:42115375-42115397 ATGTTAACAATGAGGAAACTTGG - Intergenic
1156982990 18:43314170-43314192 GTGGTAATTATGAGGAAGGTTGG + Intergenic
1157219752 18:45820012-45820034 CTGTTGTTAGTGAGAAAGCTGGG + Intergenic
1157884529 18:51353776-51353798 TTGTTCATAATCAGGAAGGTGGG - Intergenic
1157926744 18:51774971-51774993 ATCTTAAAAATGAGGAAACTGGG + Intergenic
1158407132 18:57169818-57169840 CTGTTAATTGCGAGAAAGCTGGG - Intergenic
1159852162 18:73537111-73537133 CCTTTAATAAACAGGAAGCTGGG - Intergenic
1163818024 19:19479327-19479349 CTGTTAACAATGTGGAGACTGGG - Intronic
1164261390 19:23571041-23571063 CTGCAAAGAATGAGGAAGTTAGG - Intronic
1165710822 19:38009637-38009659 ATGTTACTGATGAGGAGGCTTGG + Intronic
1167111250 19:47463027-47463049 CTATTTATAATGAATAAGCTGGG - Intronic
1168447496 19:56433394-56433416 GCGGTAATAATGAGGAATCTAGG - Intronic
928369313 2:30729254-30729276 TGGTGATTAATGAGGAAGCTAGG + Intronic
930367007 2:50452434-50452456 CATTTTATAATGAGGAAACTGGG + Intronic
931754372 2:65359335-65359357 GTGTTAAAACTGAGGAAGCTTGG - Intronic
931915884 2:66955907-66955929 ATGTTACAAATGAGAAAGCTAGG + Intergenic
931989552 2:67776343-67776365 CTGCTAAAAAAGAGGATGCTAGG + Intergenic
932999320 2:76902260-76902282 CTGTTTATAATGTGGCAGGTAGG - Intronic
933118706 2:78507358-78507380 ATGTTAACAATGAGGAAACTGGG - Intergenic
936243606 2:110808184-110808206 CTTTTCAGAAGGAGGAAGCTGGG + Intronic
937685916 2:124697178-124697200 ATGTGAATAATGAAGAAACTGGG - Intronic
939630120 2:144519488-144519510 CTGTTAATAATTACAAAACTTGG - Intronic
939908269 2:147946156-147946178 CTATAAATAAAGAGGATGCTGGG - Intronic
940523904 2:154787007-154787029 CTGTTAATAATGATAACGGTTGG + Intronic
940793854 2:158056277-158056299 ATATTAATAATGGGGAATCTCGG - Intronic
940892439 2:159048037-159048059 CTGTTACAAGTGAGGAATCTAGG + Intronic
942251408 2:174050280-174050302 ATGTTAACAATGAGGAAACTGGG - Intergenic
944946799 2:204697288-204697310 GTGTTAAGACTGAGGAACCTGGG + Intronic
944962777 2:204894490-204894512 CTGTTAATAATGAGGAAGCTGGG - Intronic
946479279 2:220038360-220038382 GTGTTACTAAAGAGGAAACTGGG + Intergenic
947102913 2:226640456-226640478 TTGTTAAAAATGAAGAATCTTGG - Intergenic
948083287 2:235225357-235225379 CTGTTACCGATGAGGAAACTGGG - Intergenic
1169505860 20:6210625-6210647 ATGTTAAAAATGAAGATGCTAGG - Intergenic
1169687821 20:8295973-8295995 CTGTTAAAAATAAGTAAACTTGG - Intronic
1170602413 20:17850823-17850845 CTTTGAACAATGAGGAAGTTAGG + Intergenic
1171384523 20:24761160-24761182 ATGTTGATAATGGGGAAGGTTGG + Intergenic
1171935348 20:31269817-31269839 TTGTTACTAATGAGGCAGTTGGG + Intergenic
1172461061 20:35119016-35119038 CTGCTACTAAGGAGGAAGCGGGG - Intronic
1172784715 20:37459886-37459908 CTGTTAAACATGAAGAAGCCAGG - Intergenic
1172829133 20:37817597-37817619 CTGTTATAGATGAGGAATCTGGG - Intronic
1172941570 20:38658066-38658088 CTGCTAGTGATGAGGAACCTTGG - Intergenic
1173670713 20:44796767-44796789 CTGTCAAATATGAAGAAGCTGGG + Intronic
1174525957 20:51171435-51171457 ATGTTACTGATGAGGAAACTGGG - Intergenic
1174589157 20:51631467-51631489 CTTTTCTTAGTGAGGAAGCTGGG - Intronic
1176132324 20:63501609-63501631 CTGTGACTAATTAGGATGCTTGG - Intergenic
1178066539 21:28910163-28910185 CTGTTTAAGATGATGAAGCTGGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1178576472 21:33796650-33796672 ATTTTACAAATGAGGAAGCTGGG - Intronic
1179202032 21:39233717-39233739 GTGTTAATAATAAAGTAGCTTGG + Intronic
1179588884 21:42392033-42392055 TTGTTAAAAATAAGGAAGATTGG + Intronic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1183965236 22:41437554-41437576 ATGTTACTAATGAGGAAACTGGG - Intronic
1184325633 22:43781777-43781799 ATGTTAATTATGGGGAAACTGGG + Intronic
1184338196 22:43868231-43868253 CTGTAACTCATGGGGAAGCTGGG - Intergenic
951310539 3:21120529-21120551 CTGTTTTTAATGAGAAAGCGCGG - Intergenic
952258703 3:31717966-31717988 CTGTTAATAATCAGAACGGTGGG + Intronic
952412717 3:33064032-33064054 CTGTTCATAAGAAGGAAGCCTGG + Intronic
955535272 3:59916683-59916705 ATTTTAGTAATGAGAAAGCTGGG - Intronic
956763352 3:72462942-72462964 CTGTTATTTATGTGGAAGATTGG + Intergenic
957127196 3:76176940-76176962 CTTTTAATAATAAGGGAGCTCGG - Intronic
957143583 3:76393611-76393633 CTGTAGATAATGAGGAAGGAAGG + Intronic
959612204 3:108307668-108307690 ATGTTAACAAAGTGGAAGCTGGG - Intronic
959804090 3:110530092-110530114 CTGTTAACAATGATAAATCTGGG + Intergenic
961869741 3:129978654-129978676 ATTTTACTAATGAGGAAGCCAGG + Intergenic
961921603 3:130432251-130432273 ATGTTAAAAATGAGGAAACTGGG + Intronic
962859999 3:139390370-139390392 CATTTAATGATGAGGAAACTCGG + Intergenic
963969623 3:151415322-151415344 AAGTTAATAATGATGAAGTTGGG + Intronic
965652815 3:170951354-170951376 CTGTTAATCCTGAGGATTCTAGG + Intergenic
968018445 3:195361050-195361072 CTGGAAATAATGAGGAATTTTGG + Intronic
969363731 4:6681783-6681805 CTGAGAATAATGAAAAAGCTGGG - Intergenic
972744237 4:41917440-41917462 CTGTTAATAACCAGAAACCTGGG - Intergenic
973097183 4:46216711-46216733 CAGTTAATGATGAAGAAGCTTGG + Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974368741 4:60986684-60986706 CTGTGAATAATGTTGAAGTTGGG - Intergenic
974462735 4:62208866-62208888 CTGTTTAAAATTGGGAAGCTGGG - Intergenic
975612328 4:76214570-76214592 CTGTTAAAGATGTGGAAGTTGGG + Intronic
977287123 4:95121657-95121679 ATGTTAACAATGAGAAATCTAGG + Intronic
977296400 4:95214309-95214331 CTGTTTATAAAAATGAAGCTAGG - Intronic
978166788 4:105618904-105618926 ATGTTAATATTGGTGAAGCTGGG + Intronic
980533826 4:134089325-134089347 ATCTCAATAATGAGGGAGCTGGG - Intergenic
980954098 4:139410686-139410708 CTGTTTAAAATGAGGTACCTAGG + Intronic
984269573 4:177534937-177534959 CTGTTTATAAAGATGCAGCTAGG - Intergenic
985155027 4:186978643-186978665 CAGTTAATAATGAGTAAAATGGG + Intergenic
986111903 5:4727636-4727658 CTGTTAATAATAGGCAAACTGGG - Intergenic
988150260 5:27368270-27368292 CTGTAAATACGGAGGGAGCTTGG + Intergenic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
989397622 5:40975165-40975187 ATGTTAATATTAAGGAAGATGGG - Intronic
990393794 5:55355436-55355458 CTGTTAAGAAGGAGGCACCTGGG + Intronic
991202263 5:64008296-64008318 CTGTAAACACTGAGGAAGCATGG - Intergenic
994207389 5:97050640-97050662 CTGTATTTAAGGAGGAAGCTGGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
994694382 5:103056174-103056196 TTGTTAAGAATGAGTAAACTAGG - Intergenic
997338289 5:133122960-133122982 CCATTAGTAATGAGGAGGCTTGG - Intergenic
997630252 5:135362297-135362319 ATGTTAACAATGGGGAAACTGGG + Intronic
997886836 5:137637746-137637768 CTGCTAAGATAGAGGAAGCTGGG - Intronic
999572584 5:152937426-152937448 CAGTAAAGAATGAGGAAGTTGGG - Intergenic
1000022982 5:157334946-157334968 ATGTTAACAGTGGGGAAGCTGGG + Intronic
1000440789 5:161260689-161260711 CTGTAAATAATGAGCAAGTTTGG + Intergenic
1001945386 5:175773643-175773665 CTGTTAATAATGATGATGATTGG - Intergenic
1002974902 6:2064898-2064920 CTGTTATGGATAAGGAAGCTGGG + Intronic
1003463884 6:6358666-6358688 ATGTTAATAATAGGGAAACTGGG - Intergenic
1005108433 6:22251078-22251100 CATTTAATTATGAGAAAGCTAGG + Intergenic
1006721008 6:36151206-36151228 ATATTAATAAGAAGGAAGCTGGG - Intergenic
1006960842 6:37928439-37928461 CTGTTAAGAATGAGTCCGCTTGG + Intronic
1007484571 6:42171997-42172019 ATTTTAAGAATGAGGAAACTGGG + Intronic
1007694345 6:43722708-43722730 CTGTTAACAATGAGGAATAATGG + Intergenic
1008560370 6:52718773-52718795 CTTTTAGTAATGAGGATTCTTGG + Intergenic
1009502903 6:64439403-64439425 ATGTTAATAATGTGAAACCTAGG - Intronic
1010059120 6:71602112-71602134 ATTTTACTGATGAGGAAGCTGGG + Intergenic
1011321139 6:86094823-86094845 CTGGTAGTACTGAGGAATCTGGG + Intergenic
1012822635 6:104106043-104106065 CTCTAAATAATGAGGATGTTGGG + Intergenic
1015610524 6:135012803-135012825 CTGTTAATAATCACAAATCTTGG - Intronic
1017504078 6:155051502-155051524 CTGTTAATAATGAGTAGGCCAGG + Intronic
1019755201 7:2763674-2763696 CTGGTAAGAATGAGAAAGCCTGG + Intronic
1021045594 7:15919024-15919046 CTGTTAATAATAAGGGAAATGGG - Intergenic
1022435196 7:30376747-30376769 CATTTAAAAATGAGGAAACTGGG - Intronic
1022593264 7:31686646-31686668 ATTTTATTGATGAGGAAGCTGGG - Intergenic
1024954634 7:54904013-54904035 GTGATAATAATGAAGAAGTTAGG + Intergenic
1026301499 7:69101947-69101969 TTGTTAATAATGAAGATTCTTGG - Intergenic
1027253265 7:76412869-76412891 ATGTAAACATTGAGGAAGCTAGG + Intronic
1027617198 7:80437986-80438008 ATATTAACAATGAGGAAACTGGG + Intronic
1027983956 7:85261477-85261499 CTATTAATACTGAGGAACCATGG + Intergenic
1029869211 7:103671434-103671456 GTCTTATTAATGAGAAAGCTGGG - Intronic
1030154831 7:106443793-106443815 ATGTTAATAGTGGGGAAACTGGG + Intergenic
1030665269 7:112270458-112270480 CTTTTAATAATGAGAAAGCTCGG + Intronic
1032663652 7:134013599-134013621 ATGTTAATAATAGGGAAACTGGG + Intronic
1033236359 7:139640909-139640931 CTTTAAAAAATGAGGAAGCTGGG - Intronic
1034149994 7:148907776-148907798 ATGTTAACAATGGGGAATCTGGG - Intergenic
1034696869 7:153061487-153061509 GTGTCAATAGTGAGGCAGCTTGG + Intergenic
1035596062 8:858937-858959 CTGTTAATGGTGGGGAAACTGGG + Intergenic
1036770681 8:11576450-11576472 CTGTTAATGCTGAGGAAGCCAGG - Intergenic
1038051887 8:23821662-23821684 TTGCTAATATTGAGGAAGTTGGG + Intergenic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1041085997 8:54256896-54256918 ATGCTAACAATGAGGAAACTGGG - Intergenic
1044080455 8:87875856-87875878 ATGTTAATAATATGGAAACTGGG - Intergenic
1045988996 8:108284107-108284129 CTGTTATGAATGAACAAGCTGGG - Intronic
1046444766 8:114303552-114303574 ATGCTAATAATAAGGAAACTGGG - Intergenic
1046634648 8:116660722-116660744 GTGTTAATATAGAGGAAGTTAGG + Intronic
1046854516 8:119016003-119016025 CTTTTACAAATGAGGAAACTGGG + Intronic
1050361425 9:4834900-4834922 CTGCTAATAATGACAGAGCTAGG + Intronic
1051582946 9:18696519-18696541 CTGTTCTTAATGATGTAGCTAGG - Intronic
1051891070 9:21943591-21943613 ATTTTAAGAATGAGAAAGCTCGG - Intronic
1052151264 9:25118990-25119012 CTGTTAATAATCAGCAGGATAGG - Intergenic
1052813162 9:33079209-33079231 CTATAAATAATGAACAAGCTTGG - Intergenic
1055002220 9:71464639-71464661 ATGTTAACAATGAGGAAGCTTGG + Intergenic
1055591923 9:77825549-77825571 CTGCTAATATGGAGTAAGCTGGG - Intronic
1055826182 9:80327708-80327730 ATATTAATAATGGGGAAACTAGG + Intergenic
1055891181 9:81125693-81125715 TTGTTAAGAATGAGTAAACTAGG - Intergenic
1056438465 9:86596356-86596378 CTATTATTGATGAGGAAACTAGG - Intergenic
1057332836 9:94131730-94131752 ATGTTAATAATAGGGAAACTGGG + Intergenic
1058578390 9:106427674-106427696 TGGTTAATTATGAGGAATCTTGG - Intergenic
1058930990 9:109718654-109718676 ATGTTAACAATGGGGAAACTAGG - Intronic
1059792121 9:117651411-117651433 CTGTTATAGATGAGGAAACTGGG + Intergenic
1059836983 9:118166167-118166189 ATGTTACTAATGAGGAAGGTGGG + Intergenic
1060572979 9:124660199-124660221 CTGTTGATAATGTGTAAGTTTGG - Intronic
1061441975 9:130611360-130611382 GTGTTACTGATTAGGAAGCTGGG + Intronic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1187691257 X:21869565-21869587 CTGTTACTAATGTGCAAGATTGG + Exonic
1189822908 X:44887574-44887596 CTATTAATAATAAGGATGCTAGG + Intronic
1194178090 X:90677218-90677240 CTGTTAAAAATGAGAAAAATGGG + Intergenic
1194764498 X:97833727-97833749 ATGTTAATAATGTGGAAGTTGGG - Intergenic
1196698709 X:118642550-118642572 CTTTTGATAATGGGGAAACTGGG + Intronic
1198802185 X:140459362-140459384 CAGTTAGTAATGAGGAATTTAGG - Intergenic
1198850744 X:140963205-140963227 TTGATAGTAATGAGGAAGATGGG + Intergenic
1199735576 X:150683141-150683163 ATGTTGATAATAAGGAAACTGGG + Intergenic
1200524756 Y:4259375-4259397 CTGTTAAAAATGAGAAAAATGGG + Intergenic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic