ID: 944965817

View in Genome Browser
Species Human (GRCh38)
Location 2:204931704-204931726
Sequence ATACAGGGCCAGTAAGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944965817_944965822 6 Left 944965817 2:204931704-204931726 CCTGTTACTTACTGGCCCTGTAT 0: 1
1: 0
2: 1
3: 9
4: 124
Right 944965822 2:204931733-204931755 AATTCACATAAATCCTCTTTGGG 0: 1
1: 0
2: 4
3: 24
4: 244
944965817_944965821 5 Left 944965817 2:204931704-204931726 CCTGTTACTTACTGGCCCTGTAT 0: 1
1: 0
2: 1
3: 9
4: 124
Right 944965821 2:204931732-204931754 TAATTCACATAAATCCTCTTTGG 0: 1
1: 0
2: 1
3: 30
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944965817 Original CRISPR ATACAGGGCCAGTAAGTAAC AGG (reversed) Intronic