ID: 944965871

View in Genome Browser
Species Human (GRCh38)
Location 2:204932661-204932683
Sequence CTTTGGAAGTAAATGTGTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 281}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944965871 Original CRISPR CTTTGGAAGTAAATGTGTCT AGG Intronic
901726654 1:11248189-11248211 CTTTGGAAGTAGTTGCGTTTCGG - Intronic
903531422 1:24033297-24033319 CTTTGGATGTGAATCTGACTGGG - Intergenic
903738069 1:25543153-25543175 CATTGGAAGAAGAAGTGTCTTGG - Intergenic
904383507 1:30126953-30126975 ATTTGCAAGTAACTGTGTGTGGG - Intergenic
906636169 1:47412118-47412140 CTTTAGAAATAAATGACTCTGGG + Intergenic
909254026 1:73395118-73395140 CACTTGAAGTAAATGTTTCTGGG - Intergenic
909541760 1:76799709-76799731 CTTTGGAAGTAAATAGTTTTAGG + Intergenic
909592119 1:77362117-77362139 CTTAGGAAATAAATGTTTGTTGG + Intronic
909736612 1:78970187-78970209 TTTTGGACAAAAATGTGTCTTGG - Intronic
910438434 1:87228642-87228664 GATTAGAAGTTAATGTGTCTGGG - Intergenic
911325302 1:96464304-96464326 CTTTGGAATGAAATGTTTCCTGG - Intergenic
912933952 1:113986631-113986653 CATTGGAAGAAAAATTGTCTTGG + Intergenic
915383235 1:155463332-155463354 CTATAGAAGTAAATGTGCCTGGG + Intronic
915748073 1:158180653-158180675 CTTTAGCAGTACATGTCTCTAGG - Intronic
916482987 1:165232259-165232281 CTTTGGAAGTTACTGTGTCTGGG + Intronic
916730847 1:167565383-167565405 CATTGGAAGAAAAATTGTCTTGG + Intergenic
916944918 1:169716800-169716822 CTTTGGATGTTAATCTGACTTGG - Intronic
917505315 1:175622173-175622195 TTTGGGAAATAAATGAGTCTTGG + Intronic
918737289 1:188080961-188080983 CATTGGAAGAAAAATTGTCTTGG + Intergenic
918775240 1:188620417-188620439 CTGTGGAAGTAAATGGAACTGGG + Intergenic
920493311 1:206436141-206436163 CATTGGAAGAAAAATTGTCTTGG - Intronic
921394404 1:214652851-214652873 CTTTAGAAGTCAATTTCTCTCGG - Exonic
922342783 1:224670835-224670857 CTTTGCATGTCAATGTGACTTGG + Intronic
922524257 1:226286816-226286838 CTTTGGAATTAAACCAGTCTTGG + Intronic
923359539 1:233197042-233197064 CTTTGGAATCAAATCTGTCAGGG - Intronic
1063523302 10:6760459-6760481 TTTTTTAAGTAAATATGTCTAGG - Intergenic
1065678661 10:28206346-28206368 ATTTGAAAGAAAATGTGTTTTGG - Intronic
1065789010 10:29242766-29242788 CTTGGAAAATAAATGTGCCTGGG + Intergenic
1066586142 10:36938524-36938546 ATTTGTTAGTAAATGTGTTTTGG + Intergenic
1067976858 10:51036398-51036420 CTTTGGAGGTAGGTGTGCCTGGG + Intronic
1068328693 10:55532017-55532039 CTTTGTAAGTAATTCTGTTTTGG + Intronic
1069244260 10:66182610-66182632 ATTTTGAAGTACATGGGTCTTGG - Intronic
1069514740 10:69068585-69068607 GGTTGGAAGGAATTGTGTCTGGG + Intergenic
1071208145 10:83307576-83307598 TTTTGGCAGTAAATGTTTATGGG - Intergenic
1072989148 10:100173749-100173771 CATTGGAAGACAGTGTGTCTAGG - Intronic
1073727322 10:106248268-106248290 CATTGGAAGTAGAATTGTCTTGG - Intergenic
1074244276 10:111672163-111672185 CTTTTGAAGTAAATGTCACAGGG - Intergenic
1077880870 11:6348842-6348864 CTTTGGTAGTAAAAGAATCTTGG + Intergenic
1079411821 11:20194909-20194931 CGTTGGAAGAAAAATTGTCTTGG - Intergenic
1081397687 11:42606130-42606152 CCTTGATAGAAAATGTGTCTTGG - Intergenic
1083182890 11:60999365-60999387 CTATGTAATTAAATGTGGCTGGG + Intronic
1083511704 11:63214792-63214814 CTTTGGATGTTAATTTGACTGGG + Intronic
1084512573 11:69615533-69615555 CTTGGGCAGTAATTGTGCCTTGG - Intergenic
1084514071 11:69626401-69626423 CTTTGGAAGAAGAATTGTCTTGG - Intergenic
1084879385 11:72159340-72159362 ATTTGGAAGTGAAGGTGTGTGGG + Intergenic
1085543104 11:77290636-77290658 CTTTTGATGTAAATGTTTATTGG - Intronic
1086539272 11:87888313-87888335 ATGTGGAAAAAAATGTGTCTTGG + Intergenic
1087803112 11:102525545-102525567 CTGTGAAAGGAAAAGTGTCTGGG - Intronic
1089161514 11:116441262-116441284 CTGTGGAGTTAAATGTGTCTGGG + Intergenic
1090945683 11:131427550-131427572 ATTTTGCAGTAAATGTGACTGGG + Intronic
1092536452 12:9392568-9392590 CTTTGGATGTTAATCTGACTGGG + Intergenic
1093658925 12:21731185-21731207 TTTTGAAAGTTAATGTGTCGGGG + Intronic
1094133055 12:27095356-27095378 GTTTGGAAGCAAATTTGGCTAGG + Intergenic
1094136377 12:27131272-27131294 CTTTGCAAGTAGATTTGCCTTGG - Intergenic
1094185995 12:27643337-27643359 CTTTGCAAGTAGATTTGCCTTGG - Intronic
1094608016 12:31966090-31966112 CTTTGGAAGAAGAATTGTCTTGG + Intronic
1095264791 12:40142617-40142639 CTTAGGAAGAAATTGTGTTTTGG - Intergenic
1096820368 12:54229075-54229097 CTTTGGAAGTAAGTGTGAGCTGG - Intergenic
1097153956 12:56999320-56999342 CTTTGGAAGTTAAGCAGTCTTGG + Exonic
1099130613 12:78825514-78825536 CCTTGGAATTAAATTTGTTTGGG - Intergenic
1099497906 12:83375439-83375461 CTTGGGAGGTATATGTGTCCAGG + Intergenic
1100196531 12:92252688-92252710 CTTAGCAAGTAAATTTGTTTAGG - Intergenic
1103679585 12:122682676-122682698 CTTTGGAATCAGATGTCTCTGGG - Intergenic
1105050109 12:133041819-133041841 CATAGGAAGTAAATATTTCTTGG + Intronic
1105481444 13:20780957-20780979 CTTGGGAAATAAATGGGTCAAGG + Exonic
1105961473 13:25345244-25345266 CTTTGGAATTAAACAGGTCTGGG - Intronic
1106457857 13:29943319-29943341 CTTTGGAGATGAATGTGGCTTGG - Intergenic
1107268982 13:38592303-38592325 CAATGGATGCAAATGTGTCTTGG + Intergenic
1107684348 13:42881660-42881682 CTTTGGAAGTAGGTTTGTATAGG - Intergenic
1108257665 13:48626390-48626412 CTTTGGATGTTAATCTGACTGGG + Intergenic
1109584913 13:64386964-64386986 CATTGGAAGAAAAATTGTCTTGG + Intergenic
1109734443 13:66463680-66463702 ATTTGAAAGAAAATGTGTGTTGG + Intronic
1110611351 13:77491562-77491584 CATTGGACGCAAATGGGTCTGGG + Intergenic
1112253180 13:97802644-97802666 ATCAGGAATTAAATGTGTCTTGG - Intergenic
1113081100 13:106521037-106521059 ATTTGGATGTATATGTGTGTTGG + Intronic
1113810947 13:113142007-113142029 CTTTGGAAGTAAATTGTTTTCGG - Intronic
1113957602 13:114107624-114107646 CTGTGGAAGCGACTGTGTCTAGG + Intronic
1114082108 14:19210295-19210317 CTTTGGATGTTAATCTGACTGGG - Intergenic
1114834975 14:26193341-26193363 TTTTGGAAGGAAATTTGTTTTGG + Intergenic
1114847213 14:26337730-26337752 CATTGGAGGTAAATCTGTTTAGG - Intergenic
1115022136 14:28694825-28694847 CATTAAAAGTAAATGTGTGTTGG + Intergenic
1115845079 14:37521230-37521252 TTTTAAAAGTAAATGTGGCTGGG - Intronic
1116167565 14:41352589-41352611 CATTGGAAGAAAAATTGTCTTGG - Intergenic
1116741185 14:48756701-48756723 GTTTTGATATAAATGTGTCTAGG - Intergenic
1118296760 14:64577231-64577253 CTTTGGAAGTAATTAAGTCACGG - Intronic
1119453619 14:74735073-74735095 CTTTGGATGTTAATCTGACTGGG - Exonic
1121461699 14:94084535-94084557 CTTTGGATGTTAATCTGACTGGG - Intronic
1121762983 14:96461372-96461394 CTGTGGAAGGAAATCTGTCAAGG + Intronic
1124065812 15:26342656-26342678 GTTTGGAAGACAATGTGACTTGG - Intergenic
1124135581 15:27033049-27033071 CTTAGTCAGTAAATGTGTCGAGG + Intronic
1124216759 15:27813525-27813547 CTTTGAAAGTAAAGGTTTGTGGG - Intronic
1126619227 15:50620368-50620390 CATTGGAAGAAAAATTGTCTTGG - Intronic
1126812032 15:52416559-52416581 CTTTGGATGTTAATCTGACTGGG - Intronic
1126844098 15:52743235-52743257 CTTTGGAAGTAAAGCGGCCTTGG - Intergenic
1127615849 15:60684691-60684713 CTTTGCAAGTGAATGTGGCAGGG + Intronic
1128384802 15:67139816-67139838 CTTGGAAAGTGAATGTGTTTAGG + Intronic
1128905534 15:71464666-71464688 CTTTAGAAGGGAAAGTGTCTAGG - Intronic
1130542907 15:84834919-84834941 CTTTGGAAGCAAATTTATTTGGG - Intronic
1131493238 15:92881145-92881167 CTTGGAAATTAAATGTCTCTTGG + Intergenic
1133012910 16:2924861-2924883 CTGTTGAAGCACATGTGTCTTGG + Intronic
1135228433 16:20682119-20682141 CTTTGGATGTTAATCTGACTGGG + Intronic
1139174049 16:64665720-64665742 CTTTTGAAGTCATTTTGTCTGGG + Intergenic
1139351093 16:66336370-66336392 CCTTGGAAGCAAAGATGTCTGGG + Intergenic
1139584079 16:67890132-67890154 CTTTGGATGTTAATCTGACTGGG - Intergenic
1140847606 16:78905279-78905301 TATTGGAAGTAAATATGTGTGGG - Intronic
1141741680 16:85897701-85897723 ATTTGTAAGTAAATCTGTGTAGG + Intergenic
1144003606 17:11078681-11078703 CTTTGAAAGTAAGTGTGTGATGG + Intergenic
1146985350 17:37211194-37211216 CTTTGTAATTAAATGAGTTTAGG + Intronic
1147278062 17:39335312-39335334 CTTTGGATGTTAATCTGACTGGG + Intronic
1149609827 17:57952124-57952146 CTTGGGAATTGAAAGTGTCTTGG - Intronic
1150237096 17:63601832-63601854 CCTTCCAAGGAAATGTGTCTTGG - Intronic
1151844370 17:76641262-76641284 TTTTGGATGTTAATGTGACTGGG + Intronic
1152966890 18:124628-124650 ATTTGGCAGTAAATATATCTAGG - Intergenic
1153454482 18:5265080-5265102 CTTGGGAAGTGTATGTGTCCAGG - Intergenic
1153963062 18:10156380-10156402 CTTTGGAAGGAAATGTGGTAAGG - Intergenic
1154059221 18:11043656-11043678 TTTGGGAAGTATATGTGTTTAGG - Intronic
1154927096 18:20947426-20947448 ATTTGGCAGTAAATATATCTAGG + Exonic
1160071443 18:75632235-75632257 ATTTGGAAATAAATGTGTGTGGG - Intergenic
1164054697 19:21612561-21612583 CTTTGGATGTAAATCTGACTGGG + Intergenic
1164081330 19:21863969-21863991 CTTTGGATGTTAATCCGTCTGGG - Intergenic
1165694303 19:37888898-37888920 CTTTGGAGGAAGAAGTGTCTCGG - Exonic
1166010951 19:39942424-39942446 CTTTGGATGTTAATCTGACTGGG + Intergenic
1166235677 19:41454103-41454125 CTTTGGGAGTAAATTTGCATAGG - Intergenic
1166518100 19:43462182-43462204 CTTTGAATGGAAATGTGTGTAGG + Intronic
1166650868 19:44574082-44574104 CTTTGGATGTTAATCTGACTGGG + Intergenic
1168216369 19:54929010-54929032 CTTTGGAAATAAAGGTATCACGG + Intronic
925068005 2:944109-944131 CTTTGGAAGGAGATGTGTGTTGG + Intergenic
926073317 2:9919226-9919248 CTTTGGATGTACATGTGCCCTGG - Intronic
926279594 2:11434860-11434882 CTTTGTAATAAAATGTGTATGGG - Intergenic
926727048 2:16006680-16006702 CTTTGGAGGCAGATGAGTCTGGG + Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929255822 2:39810415-39810437 CTTGGGAGGTATATGTGTCCAGG + Intergenic
930337253 2:50064717-50064739 CTTTGGAAGTAAATGCTCCTTGG - Intronic
930788204 2:55293763-55293785 CTCTGGAAGTAAATGGATCAGGG + Intronic
932089678 2:68794997-68795019 CTTGGGAGGTATATGTTTCTAGG + Intronic
932418554 2:71588102-71588124 CTATGGGAGTGAGTGTGTCTGGG + Intronic
932998720 2:76892798-76892820 CTCAGGAAATAAATGTGTTTGGG - Intronic
934920975 2:98345378-98345400 CTTTGGGGGAAAATTTGTCTAGG + Intronic
936530341 2:113272004-113272026 CTTTGGATGTAAATGTGACATGG + Intronic
937578512 2:123454877-123454899 CATTGGAAGTAAGTGATTCTAGG - Intergenic
938494478 2:131786304-131786326 CTTTGGATGTTAATCTGACTGGG + Intergenic
939150837 2:138470700-138470722 CTTTGGCACTAAATTTGACTCGG + Intergenic
939568149 2:143809083-143809105 CTTTTAAAGAAAATGTTTCTGGG + Intergenic
939707574 2:145474528-145474550 CTTGGTAAGTTTATGTGTCTAGG + Intergenic
939794588 2:146626482-146626504 CTGTGGAAGTAAAAATGACTTGG + Intergenic
941506665 2:166354787-166354809 TTCTGCAAATAAATGTGTCTTGG - Intronic
941576067 2:167231875-167231897 CATTGTCAGTGAATGTGTCTGGG + Intronic
942082769 2:172416924-172416946 CTGTGGAAGTAAAGCTATCTTGG - Intergenic
942503205 2:176614021-176614043 CTTTGGCAGTATATGTGTTAGGG + Intergenic
942808069 2:179958612-179958634 CATTGGAAGAAAAATTGTCTTGG - Intronic
943184910 2:184596120-184596142 TTTTGGAATGAAATGTTTCTGGG - Intergenic
943738903 2:191389630-191389652 CTTTGCAAGTAGATGTGGCCAGG - Intronic
944948759 2:204722386-204722408 CTTTGGCAGTGACAGTGTCTTGG + Intronic
944965871 2:204932661-204932683 CTTTGGAAGTAAATGTGTCTAGG + Intronic
945198384 2:207258173-207258195 ATTTGGAAATAAAGGTGGCTGGG - Intergenic
946073001 2:217050412-217050434 CTTGGGCAGTAAATTTCTCTGGG + Intergenic
1170222119 20:13952205-13952227 GTTTGGGAAAAAATGTGTCTTGG - Intronic
1170991864 20:21309590-21309612 CTTTGGAAGAAGAATTGTCTTGG - Intronic
1171058813 20:21935433-21935455 GTCTGGAAGTAAAAGAGTCTGGG + Intergenic
1171330381 20:24332234-24332256 CATTGGCAGTAATTGTGCCTGGG - Intergenic
1174372731 20:50103790-50103812 GTGTGGAAGTAAAGGTGTTTGGG - Intronic
1175612422 20:60362909-60362931 TGTTGGAAGGAGATGTGTCTCGG - Intergenic
1176613464 21:9008072-9008094 CTTTGGATGTTAATCTGACTGGG - Intergenic
1176711731 21:10155810-10155832 CTTTGGATGTTAATCTGACTGGG + Intergenic
1176979662 21:15366477-15366499 CTTTTTCAGTAAATGTATCTGGG + Intergenic
1177320273 21:19512162-19512184 ATTTGAAAATAAATGTATCTGGG + Intergenic
1177815247 21:25969523-25969545 CTTTGTAATAAAATGTGGCTGGG - Intronic
1178779900 21:35592649-35592671 CTTTGAAACCAAATGTTTCTGGG - Intronic
1180498666 22:15912375-15912397 CTTTGGATGTTAATCTGACTGGG + Intergenic
1181555823 22:23671201-23671223 CTTTGGAAGGAACTGAGCCTGGG - Intergenic
1181914788 22:26271077-26271099 CTTTGGGTGCACATGTGTCTGGG + Intronic
951157086 3:19368723-19368745 ATTTGAAAGTTATTGTGTCTTGG + Intronic
952401448 3:32967587-32967609 CTTTGGATGTTAATCTGACTGGG + Intergenic
953052094 3:39353916-39353938 CTTTGGATGTTAATCTGACTGGG + Intergenic
955456136 3:59123651-59123673 GTTCCAAAGTAAATGTGTCTAGG - Intergenic
957614984 3:82515678-82515700 CTTTGGAAGAAGAATTGTCTTGG + Intergenic
957864665 3:86006369-86006391 GTTTAGAAGTACATATGTCTTGG + Intronic
957948534 3:87094970-87094992 CTTGGGAAGTGTATGTGTCGAGG + Intergenic
960508890 3:118525113-118525135 TTTTGTAACTAAATGTGTATTGG - Intergenic
960857423 3:122117495-122117517 CTTGGGATGTAAATTTCTCTAGG - Intronic
962281269 3:134053709-134053731 CTCTGGATGTTTATGTGTCTAGG + Intergenic
962564711 3:136645961-136645983 CTTTGGAATTGAAAATGTCTAGG - Intronic
962983636 3:140513740-140513762 ATTTAGATGTAAATCTGTCTGGG + Intronic
964662691 3:159138047-159138069 TCTTGGAAGTAAATGTAACTAGG + Intronic
965727042 3:171728977-171728999 AATTGAAAGTAAATGTGTCAGGG + Intronic
966408817 3:179627587-179627609 CTTTGGATGTTAATCTGACTGGG + Intronic
966834777 3:184040803-184040825 CTTTGGAGCCAAATGTGTTTTGG + Intergenic
967630698 3:191740639-191740661 TTCTGGAAGTTAATATGTCTGGG - Intergenic
968378032 4:60946-60968 CATTGGAAGAAGATTTGTCTTGG + Intronic
969849118 4:9942897-9942919 CTTGGGAAATAAACGTGTCAAGG - Intronic
971495357 4:27258688-27258710 CTTTGGAAGTTGATGTGTTTTGG + Intergenic
971573301 4:28241751-28241773 CTTTGGAAGCCAATGTGACTAGG + Intergenic
973059278 4:45699912-45699934 CTGTGGCATTAAATATGTCTTGG + Intergenic
973082847 4:46015723-46015745 CTTTAGAATTAAATGTATCTAGG - Intergenic
973863685 4:55090790-55090812 TTTTGTAAGAAAATGAGTCTTGG + Intronic
974105339 4:57463444-57463466 CTTTGGAATTAGATGGGCCTGGG + Intergenic
974995216 4:69147560-69147582 CTTTGGATGTGATTGTGTTTTGG + Intronic
975858636 4:78652031-78652053 CATTGGAAGAAAAATTGTCTTGG - Intergenic
976029737 4:80737509-80737531 CTTTGTAGGTTTATGTGTCTAGG + Intronic
976854375 4:89585470-89585492 CTTTGGAAGCAAATGGGTACTGG + Intergenic
977749407 4:100590925-100590947 TTTTGGCAGTAAAGGTGGCTAGG - Intronic
978455546 4:108886522-108886544 CATTGGAAGAAAAACTGTCTTGG - Intronic
978715412 4:111836871-111836893 ATGTGGAAGTAAAGGTGACTTGG - Intergenic
979963817 4:127053351-127053373 CTTTGCAAGTAAGAGTGTTTGGG - Intergenic
981067472 4:140499813-140499835 CATTGGAAGGAAAATTGTCTTGG + Intergenic
982589840 4:157294000-157294022 CTTTGAAAATAAATGTATGTGGG + Intronic
982789291 4:159572454-159572476 CTAAGGATATAAATGTGTCTTGG - Intergenic
984272193 4:177560314-177560336 CTTTGGAATACAATGTGTCTAGG - Intergenic
986097129 5:4569985-4570007 CTTTAGAAGGAATTGTGTCTGGG - Intergenic
986486313 5:8241946-8241968 CTTTGGAAGGAAATTGGTTTTGG + Intergenic
987165044 5:15189244-15189266 CTTAGAAACTAATTGTGTCTTGG - Intergenic
988184826 5:27846768-27846790 CGTTGGAAGTAAATGAATCATGG + Intergenic
989344032 5:40408995-40409017 CTTTGGAAGAATATCTGTTTGGG - Intergenic
992406644 5:76464149-76464171 CTTTCAAAGTATTTGTGTCTTGG - Intronic
994024598 5:95068178-95068200 ATTTGGAGTCAAATGTGTCTTGG - Intronic
995142872 5:108752659-108752681 CTTTGGAATTCAAAGTATCTAGG + Intronic
995227648 5:109720615-109720637 CATTGGAAGAAAAATTGTCTTGG + Intronic
996423607 5:123289183-123289205 ATTTGGAAGTATATGTTTCAAGG - Intergenic
996921986 5:128778756-128778778 CTTTGCATGTAAATCTGTGTGGG + Intronic
997098819 5:130945199-130945221 CTCTGAAAGAAAATGTATCTAGG + Intergenic
997215244 5:132104479-132104501 CTTTGGAAGAAGAATTGTCTTGG + Intergenic
997349528 5:133220729-133220751 CTATGTAAGTAACTGTGCCTGGG - Exonic
997985811 5:138500803-138500825 TTTTAAAAGTAAATGTGTGTAGG - Intergenic
998051700 5:139041378-139041400 CTTTAGAACTAAATATTTCTGGG - Intronic
998236720 5:140403993-140404015 CTTTGGAAAAAAAAGTGTGTGGG + Intronic
998260028 5:140623461-140623483 CTTTGGATGTTAATCTGACTGGG + Intergenic
999635378 5:153616410-153616432 CTTTGGAAGAAGAATTGTCTTGG + Intronic
1000164978 5:158639623-158639645 ATTTGGGGGTAAAAGTGTCTAGG + Intergenic
1000180598 5:158806750-158806772 CTTTGGAAGTAGATGCCCCTAGG + Intronic
1000212969 5:159126055-159126077 CATTGGAAGACAAAGTGTCTTGG + Intergenic
1000789720 5:165590797-165590819 GTTTGGAAAAAAATGTGTTTTGG - Intergenic
1001672964 5:173489946-173489968 CTTTGAAATCAAATGTGTCTGGG - Intergenic
1003323220 6:5071392-5071414 CTCAGGAAGAAAATGTATCTTGG + Intergenic
1006979965 6:38139548-38139570 CTTTGGAAGTCAGTGTGTCTGGG + Intronic
1008802461 6:55386480-55386502 TTTTGTAAGTATATGTGTATAGG + Intronic
1009236144 6:61125856-61125878 GTTTGTAATTAAATGTGTCATGG + Intergenic
1009269809 6:61602294-61602316 CTTTGGAAGTTCTTGTGTCCTGG - Intergenic
1009559163 6:65217172-65217194 CTTGAGAAGTAAATGAATCTTGG + Intronic
1009649371 6:66453583-66453605 CTTTGGAAGTGACTTTGTTTTGG - Intergenic
1012033890 6:94107401-94107423 CTTTGAAAGAAAATAAGTCTGGG + Intergenic
1012283043 6:97352487-97352509 ATTTTGAAGGAAATGTGTATTGG + Intergenic
1012552791 6:100479576-100479598 CCTTGCAAGTAAATGTCACTTGG - Intergenic
1014784371 6:125600694-125600716 CTTTGAATGTAAATGTTTATTGG - Intergenic
1015063093 6:128991958-128991980 CTTTGCAAATAAATGTGTTCTGG - Intronic
1015988307 6:138908630-138908652 CCTAGTAATTAAATGTGTCTAGG + Intronic
1016398839 6:143656362-143656384 CATTGGAAGTAGAATTGTCTTGG + Intronic
1016642144 6:146361342-146361364 CTTTGGCTGTACTTGTGTCTTGG - Intronic
1017263358 6:152413875-152413897 CTTTGGTAAGAAATGTTTCTGGG + Intronic
1018556940 6:165060012-165060034 CTATGGAAATTAATGTGACTAGG - Intergenic
1020391685 7:7664970-7664992 ATTTGGAATAAAATGTGTGTGGG + Intronic
1021522271 7:21550021-21550043 TTTTGGAAGTTAATATGGCTGGG - Intronic
1022408802 7:30119666-30119688 CATTGTAATAAAATGTGTCTTGG - Intronic
1022461770 7:30615706-30615728 ATTTTGAATTAAATTTGTCTGGG - Intronic
1023643100 7:42281505-42281527 CTTTGAAGGTTAATGTGTCAAGG - Intergenic
1027903042 7:84142775-84142797 CTTTGGAGGGAAATATCTCTTGG - Intronic
1028090805 7:86698383-86698405 CTTTGGATGTTAATCTGACTGGG + Intronic
1029011648 7:97268471-97268493 CTTTGCAAATAAAAGGGTCTTGG + Intergenic
1029066822 7:97858007-97858029 TTTTGAAAGTAAAGGTGTCTGGG - Intronic
1030657100 7:112180458-112180480 GTTTGGAAGTAAGTGTGAGTTGG + Intronic
1037562461 8:20087202-20087224 CTGTGGCAGTAAATGTCCCTTGG - Intergenic
1038301721 8:26356656-26356678 TTTTAGAAGTAAATGTTCCTAGG + Intronic
1038357597 8:26844053-26844075 CTTTGGTATTAGATGTGTTTTGG + Intronic
1038979502 8:32742325-32742347 CGTTGGAAGAAAATGTTTCTCGG - Intronic
1041391687 8:57352758-57352780 TTTTGGAAGTAGATGTGTGATGG - Intergenic
1042697716 8:71575081-71575103 CTTTGGAAGTTTATGTCTCTTGG + Intronic
1043874346 8:85467324-85467346 CTTTGGGAGTAATACTGTCTAGG + Intronic
1044250129 8:89996534-89996556 CTCTGGAAGTAAATGGGAATTGG + Intronic
1044365847 8:91344312-91344334 GTTTTGAAGTAAATCTATCTGGG - Intronic
1046461345 8:114541504-114541526 GTGAGAAAGTAAATGTGTCTTGG - Intergenic
1048038470 8:130700935-130700957 CTTTGGAAGAAGAATTGTCTTGG + Intergenic
1049313922 8:141948861-141948883 CTTTGGAAGTAAGACTGGCTAGG - Intergenic
1051364117 9:16308854-16308876 CTGAAGAAGTAAATGTGTCCAGG - Intergenic
1052561214 9:30087112-30087134 CTTTGGAAGTATATTAGTCAGGG + Intergenic
1052614644 9:30822016-30822038 CTGTGGAAGTAATTGAATCTTGG + Intergenic
1053120373 9:35542047-35542069 CCTTGTAAGTAAATGTGAATGGG + Intronic
1053521407 9:38783744-38783766 CTTTGGAAGCAATTGTGAATGGG - Intergenic
1054193573 9:62007737-62007759 CTTTGGAAGCAATTGTGAATGGG - Intergenic
1054329701 9:63739442-63739464 CTTTGGATGTTAATCTGACTGGG + Intergenic
1054644835 9:67580954-67580976 CTTTGGAAGCAATTGTGAATGGG + Intergenic
1058229811 9:102411870-102411892 CTTTGTAGATAAATGTGTTTAGG - Intergenic
1058524560 9:105844022-105844044 CATTGGAAGAAAAGTTGTCTTGG + Intergenic
1060271086 9:122142250-122142272 CTTTGGAATCAGATGTATCTGGG + Intergenic
1060537357 9:124400835-124400857 TTTTGGTAACAAATGTGTCTTGG - Intronic
1060634235 9:125187570-125187592 CTTTTTATGAAAATGTGTCTAGG - Intronic
1060702316 9:125767182-125767204 CATTGGAAGTAATTTTGTCATGG + Intronic
1202796486 9_KI270719v1_random:124799-124821 CTTTGGATGTTAATCTGACTGGG + Intergenic
1203571207 Un_KI270744v1:133303-133325 CATTGGAAGAAGATTTGTCTTGG - Intergenic
1186661054 X:11667294-11667316 CATTAGAAGTAAAAGTGTGTGGG + Intergenic
1186693190 X:12001752-12001774 CTTTGTAATTAAATGAGACTCGG + Intergenic
1189826795 X:44926910-44926932 CTTGGCCAGTAATTGTGTCTCGG + Intronic
1189916187 X:45857973-45857995 CTCTGAGAGTAAATGTGTCTCGG - Intergenic
1190342390 X:49308172-49308194 CTTTGGATGTTAATCTGACTAGG + Intronic
1191127980 X:56978202-56978224 CTTTGGAGGAAATTCTGTCTAGG - Intronic
1193924667 X:87468938-87468960 CTTTGGATGTTAATCTGACTGGG - Intergenic
1193945168 X:87725080-87725102 CTTGGGACAAAAATGTGTCTGGG + Intergenic
1196009016 X:110866457-110866479 TTTTGGAAGGAGATGTGTTTTGG + Intergenic
1199740837 X:150734677-150734699 CTATGGCAGTATATGTGTCTAGG + Intronic
1199825035 X:151490292-151490314 CTTTGGAAGAAGAATTGTCTTGG + Intergenic
1201276474 Y:12303451-12303473 CATTGGAAGAAAAATTGTCTCGG - Intergenic
1201357279 Y:13111444-13111466 CTTTGGATGTTAATCTGACTGGG + Intergenic
1202365883 Y:24164394-24164416 CTGTGGCAGTAAATGTATCCTGG + Intergenic
1202504899 Y:25505728-25505750 CTGTGGCAGTAAATGTATCCTGG - Intergenic