ID: 944966903

View in Genome Browser
Species Human (GRCh38)
Location 2:204945250-204945272
Sequence GTTCCTAAGGGGATCATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 1, 2: 21, 3: 51, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944966892_944966903 7 Left 944966892 2:204945220-204945242 CCTTAACTTTGTTTTCCTGAGGG 0: 1
1: 0
2: 0
3: 24
4: 225
Right 944966903 2:204945250-204945272 GTTCCTAAGGGGATCATGGAGGG 0: 1
1: 1
2: 21
3: 51
4: 153
944966897_944966903 -8 Left 944966897 2:204945235-204945257 CCTGAGGGGCTCTGGGTTCCTAA 0: 1
1: 0
2: 1
3: 10
4: 133
Right 944966903 2:204945250-204945272 GTTCCTAAGGGGATCATGGAGGG 0: 1
1: 1
2: 21
3: 51
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944966903 Original CRISPR GTTCCTAAGGGGATCATGGA GGG Intronic
900388687 1:2423559-2423581 GTTCTTAAGGAGATTATGGAGGG + Intergenic
901722830 1:11213912-11213934 GGACCCAAGTGGATCATGGAAGG - Intronic
902548893 1:17207792-17207814 GTTCCTGAAGGGCTCTTGGATGG - Intronic
903545447 1:24120957-24120979 GGTCCGAGGGGGAACATGGACGG + Exonic
904362563 1:29986270-29986292 GTTTTTAAGGGGACCATAGAGGG - Intergenic
906326523 1:44849563-44849585 GTTCCAAAGGGGACCATGTTGGG + Intergenic
907888071 1:58612285-58612307 ATCCACAAGGGGATCATGGAGGG - Intergenic
907888284 1:58614244-58614266 GTTTTTAAGGAGATCCTGGAGGG - Intergenic
907911774 1:58833584-58833606 GTTTCATAGGGGATCAGGGAGGG - Intergenic
909559444 1:76993164-76993186 GTTCGCAAAGGCATCATGGAGGG - Intronic
911077042 1:93886563-93886585 TTTCTGAAGGGGATCATGTATGG - Exonic
911823796 1:102454040-102454062 GACCCTAAGGGCATCATGGATGG + Intergenic
913118386 1:115717445-115717467 GTTTTTAAGAGGATCATGGAAGG - Intronic
913265031 1:117035363-117035385 CTTCCTAAGGGGATTATTGGTGG + Intronic
913480610 1:119285684-119285706 GGTTTTAAGGGGATTATGGAGGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915878900 1:159644258-159644280 CCTTTTAAGGGGATCATGGAAGG + Intergenic
918217528 1:182405628-182405650 AGTTTTAAGGGGATCATGGAGGG - Intergenic
918979482 1:191537118-191537140 GCTTTTAAGGGGATCATGGAGGG - Intergenic
919369930 1:196710188-196710210 GACCTTAAGGGGATCATGGAGGG - Intronic
919382506 1:196876229-196876251 GACTTTAAGGGGATCATGGAGGG - Intronic
920752931 1:208698616-208698638 GTTTTTAAAAGGATCATGGAGGG - Intergenic
922421373 1:225463018-225463040 ATTTTTAAGGGGATCATGGAGGG - Intergenic
924034552 1:239923172-239923194 GTTTTTAAGGGGATTATGGAAGG + Intergenic
1063371858 10:5527402-5527424 ATTCCTGAGGGGATGCTGGATGG + Intergenic
1064222109 10:13450401-13450423 GTTCCTATCGGCATCATGGAAGG + Intronic
1064984629 10:21197920-21197942 TTTCTTAAGGGAATCATGGAGGG - Intergenic
1068823923 10:61411350-61411372 GATCCTAAGGGGAAGATTGAGGG - Intronic
1068877474 10:62011966-62011988 GGTACTAAGGGGATGAAGGAGGG - Intronic
1069171420 10:65234535-65234557 GTTTTTATGGGGATCATGAAAGG - Intergenic
1069175133 10:65280902-65280924 ATTTCTAAGAGGATCATGGAGGG + Intergenic
1069925548 10:71848098-71848120 TTTACAAATGGGATCATGGAGGG - Intronic
1071361598 10:84851737-84851759 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1077388908 11:2290263-2290285 GTTGCTGAGGGGCTAATGGAAGG + Intergenic
1080409982 11:32014305-32014327 GCTCCTAAGGTGCTCACGGAGGG + Intronic
1081266502 11:41030418-41030440 GTCCCTAAGGGTGTCATTGAGGG - Intronic
1086055773 11:82644309-82644331 GGTCCTAATGGGACAATGGAAGG + Intergenic
1087904163 11:103676134-103676156 GTTCCCAAGGAGACCATGGTTGG + Intergenic
1089750385 11:120647514-120647536 GTTCCTGAGGGGCTCAGAGATGG - Intronic
1091074706 11:132604503-132604525 GTTCATAAGGGCATCAGAGAGGG - Intronic
1092501720 12:9053968-9053990 GCTTTTAAGGGGATCATGGAGGG - Intergenic
1093742723 12:22706680-22706702 GTTCCTAAGGCCATCAAGCAAGG - Intergenic
1093805037 12:23421883-23421905 ATCGCTAAGGGGATCATGGAAGG - Intergenic
1094417294 12:30230871-30230893 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1097010817 12:55952490-55952512 GTTCCTAAGGGTGCCATGGAGGG - Intronic
1098950545 12:76636481-76636503 GTTTTTCAGGGGGTCATGGAGGG + Intergenic
1106291917 13:28371476-28371498 GCTCCTAAGGGATTCATAGATGG - Intronic
1109533066 13:63678669-63678691 GTTCCCAAGGGGATGAAGTAAGG + Intergenic
1111102107 13:83601837-83601859 GTTTTTAAGGGGATCATGGTGGG - Intergenic
1112543965 13:100346253-100346275 GTTCTTAAGGGGATCTAGAATGG - Intronic
1112622355 13:101065400-101065422 GTACCTCAGGACATCATGGAAGG + Exonic
1119298320 14:73551255-73551277 GTTTTTAAAGGGATCATGGAGGG - Intronic
1119302616 14:73583442-73583464 GTTTTTAAAGGGATCATGGAGGG - Intergenic
1123804253 15:23854887-23854909 GTTGCCAAGGGGATCAGAGAAGG + Intergenic
1124198014 15:27650221-27650243 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1124217253 15:27817607-27817629 GTTTCTAAGAGGATCATGGAGGG - Intronic
1124988215 15:34644245-34644267 GTTTTTAAAGGGATCATCGAAGG + Intergenic
1127292603 15:57583564-57583586 GCTTTTAAGGGGATCATGGAGGG + Intergenic
1130026511 15:80275466-80275488 GTTTATAAGGAGATCATGGAAGG - Intergenic
1130689872 15:86072916-86072938 GTTTCTAAGCGGATCATGGAGGG - Intergenic
1130741586 15:86606285-86606307 GTTTCTAAGGAGATTGTGGAAGG - Intronic
1133849865 16:9492637-9492659 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1134365226 16:13570936-13570958 ATTTTTAAGGGGATCATGAAGGG + Intergenic
1134905795 16:17978490-17978512 GGTCCTGAGGGGATGAGGGAGGG - Intergenic
1136179743 16:28542859-28542881 GCTTTTAAGGGGATTATGGAGGG + Intergenic
1136563575 16:31055986-31056008 GTTTCTAAGGGGACTGTGGAGGG + Intergenic
1137044242 16:35641454-35641476 GTCCCTATGGGGATTATGGAAGG + Intergenic
1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG + Intergenic
1137674713 16:50298655-50298677 GTTCCTAAGGGCCTCGGGGAGGG - Intronic
1139975201 16:70804434-70804456 GTTTTTAAGGGGATCCTGGAGGG + Intergenic
1140399224 16:74656764-74656786 GTTCTTAGGGGCATCAAGGATGG - Intronic
1141525221 16:84606789-84606811 GACCCTAAGAGGAACATGGAGGG - Intronic
1143267538 17:5651428-5651450 GCTTTTAAGGGGATCATGGAGGG - Intergenic
1143556957 17:7667992-7668014 GTTCCCAAGGGGAACAGGGGTGG - Intronic
1147472328 17:40674607-40674629 TTTCCTGAGGGGATCAGAGAAGG + Intergenic
1148220774 17:45860261-45860283 GTCTCTAAGGGGATTGTGGAGGG + Intergenic
1148972311 17:51494502-51494524 GCTTTTAAGGGGATTATGGAAGG + Intergenic
1150260348 17:63784836-63784858 GTTCCTAAGGAAATAATTGAAGG + Intronic
1150498589 17:65628730-65628752 TTGCCTAAGAGGATCGTGGAGGG - Intronic
1152266374 17:79297260-79297282 GATCCCAAGGGGCCCATGGAAGG - Intronic
1152285221 17:79408587-79408609 GTTGCTAAGGGGGTGCTGGATGG + Intronic
1155329776 18:24703375-24703397 GTCTCTAAGGAGATCATGGAGGG - Intergenic
1155603886 18:27581611-27581633 GCTTTTAAGGAGATCATGGAGGG - Intergenic
1155851056 18:30774566-30774588 GTTTTTGAGGGGATCATGGAGGG - Intergenic
1157115560 18:44859434-44859456 ATTCCCAAGGGGATCATGGATGG + Intronic
1157324924 18:46662128-46662150 GCTTTTAAGGGGACCATGGAGGG - Intergenic
1157733506 18:50025401-50025423 GTTTTTAAGGGGATCACAGAGGG - Intronic
1158872632 18:61703147-61703169 GTTTTTAAGGGGATTCTGGAGGG - Intergenic
1159067452 18:63585966-63585988 TTTCCAAAGGGGAGCATTGAAGG + Intergenic
1161687727 19:5711659-5711681 CTTCCTAAGGGGCTCAGGGTGGG + Intronic
1162244268 19:9386315-9386337 GTTTTAAAGGGGATCAGGGAGGG + Intergenic
1162883782 19:13681000-13681022 GGTTTTAAGAGGATCATGGAGGG + Intergenic
1165302079 19:34976672-34976694 GATTTTAAGGGGATCATGGAAGG - Intergenic
1166360258 19:42250168-42250190 GTTACCAAGGGGCTCAGGGAAGG + Intronic
926901424 2:17754680-17754702 GTGCCTATGGGGACCAGGGAGGG - Intronic
929419994 2:41780838-41780860 GTTTTTAAGGGGATCATGGAGGG - Intergenic
929848190 2:45555073-45555095 ATTTTTAAGGGGATCGTGGAGGG - Intronic
930117313 2:47729610-47729632 GTTTTTAAGGGGATCATGGAGGG + Intronic
930660158 2:54045246-54045268 GTTTTTAAGGGGATCGTGGAGGG - Intronic
932841297 2:75085283-75085305 GTTTTTTAGGAGATCATGGAGGG - Intronic
933611362 2:84439387-84439409 GGTCTTAAGGTGAGCATGGAAGG - Intronic
933619448 2:84520713-84520735 GTTCCTCAGAGGAACATGGATGG - Intronic
934859957 2:97756150-97756172 GTTCCCATGGCAATCATGGAGGG - Intergenic
934971600 2:98768783-98768805 GTTCCTAAGGGCATCAGACACGG + Intergenic
937816491 2:126256511-126256533 GCTTTTAAGGGGATCATGGAGGG - Intergenic
938208332 2:129442670-129442692 GTTTCTATGGGGATCATGGAGGG - Intergenic
938251054 2:129816027-129816049 GTTTTTAAGGGGAATATGGAGGG + Intergenic
940158176 2:150681404-150681426 GTTTTTAAGAGGATCATGGAGGG + Intergenic
941488414 2:166111704-166111726 GTTCTTAATGGGATCTAGGATGG - Intronic
942738110 2:179139808-179139830 GTTTTTAAGGGGATCATGTAGGG - Intronic
943471342 2:188297572-188297594 GTTCCTGGGGGAACCATGGATGG + Intronic
944966903 2:204945250-204945272 GTTCCTAAGGGGATCATGGAGGG + Intronic
947308851 2:228778282-228778304 GTTTTTAAGGGGATCATGGAAGG - Intergenic
948962943 2:241355320-241355342 GGACCGAAGGGGATCATCGAAGG - Intergenic
949013039 2:241692761-241692783 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1169082365 20:2805243-2805265 GATCCAAAGGGGGTCTTGGAGGG - Intergenic
1172113920 20:32562873-32562895 GTTCCTAAGGAGGGCAGGGAGGG + Intronic
1172119195 20:32587849-32587871 TTTCTTAGGGGGATCAGGGAAGG + Intronic
1172731132 20:37089034-37089056 GTTGGAAAGGGTATCATGGAAGG - Exonic
1176904609 21:14484346-14484368 GCACCAAAGGGAATCATGGAAGG + Intergenic
1178910820 21:36671846-36671868 GATTCTAAGGTGATCATGAATGG + Intergenic
1179892847 21:44345628-44345650 GTTCCCAAGGGCATCTGGGAGGG - Intergenic
1180172447 21:46066867-46066889 GTTTCTAAAGGGCTCCTGGATGG - Intergenic
1181791378 22:25269572-25269594 TTTTTTACGGGGATCATGGAGGG + Intergenic
1181827072 22:25525683-25525705 TTTTTTAAGGGGATCATGGAGGG + Intergenic
1182543296 22:31057268-31057290 GTTTCTCAGGGCACCATGGAAGG - Intergenic
1183163559 22:36131078-36131100 GTTTCTCAGAGGATCAGGGAGGG - Intergenic
1183188298 22:36305055-36305077 ATTCCCAAGGGTTTCATGGACGG - Exonic
1183283510 22:36947561-36947583 GTTTTTAAGGGGATTATAGAGGG - Intergenic
949606211 3:5657093-5657115 TTTTTAAAGGGGATCATGGAGGG + Intergenic
949991587 3:9583625-9583647 GCTTTTAAGGGGATCGTGGAAGG + Intergenic
952693133 3:36233598-36233620 GCTTTTAAGGGGATGATGGAGGG - Intergenic
955176092 3:56614405-56614427 GTTCCTAAGTGGATAATGATAGG - Intronic
957201461 3:77141460-77141482 CTTCTTACGGGCATCATGGAAGG - Intronic
962064063 3:131960814-131960836 GGTTTTAAGGGGATTATGGAGGG - Intronic
962095490 3:132288312-132288334 GTTTTTAAGGGGATCATGGAGGG + Intergenic
965160345 3:165125159-165125181 GTTCCAGAGGGTATCTTGGAAGG + Intergenic
965374451 3:167905592-167905614 GGTCTAAAGGGGATCATGAATGG + Intergenic
968021763 3:195398175-195398197 GTTTCTAAGGTTATCAAGGAAGG + Intronic
968939173 4:3629156-3629178 GTTTTTAAGGGGATCATGGAAGG - Intergenic
969930008 4:10621656-10621678 GTTCCTAATGTCATCCTGGAGGG - Intronic
970202181 4:13621106-13621128 CTCCCTGAGGGGAACATGGAGGG + Intronic
972844745 4:42974178-42974200 GTTTTTAAGTGGATCATGGAGGG + Intronic
974480538 4:62437581-62437603 GTTTTTAAGGGGATTATGGAGGG + Intergenic
974595385 4:64008106-64008128 GTTTGTAAAGGGATCCTGGAAGG - Intergenic
975021581 4:69497334-69497356 GTTTTTAAGGGGTTAATGGAGGG - Intronic
977059483 4:92239545-92239567 GTTTATAAGGGGATCATGGAAGG - Intergenic
978579176 4:110215640-110215662 GTTTTTAAGGGGATCGTAGAGGG + Intergenic
979609946 4:122679283-122679305 GTTCATAAGGGCTTCATTGATGG + Intergenic
979981335 4:127258913-127258935 GTGAGTAAGGGGATAATGGAAGG - Intergenic
983249179 4:165325880-165325902 GCTTTTAAGGGGATCCTGGAGGG + Intergenic
983373339 4:166893273-166893295 ATTCCTAAGGGAAATATGGAAGG - Intronic
983451564 4:167918212-167918234 GTTTTTAAGGGGATCATGGAGGG + Intergenic
983844932 4:172506332-172506354 GTTTTTATGAGGATCATGGAGGG - Intronic
984537639 4:180996896-180996918 TTTTCTAAGGGGTTCAGGGAAGG + Intergenic
984893036 4:184510358-184510380 GCTTTTAAGGGGATCATGAAGGG + Intergenic
986297409 5:6450135-6450157 GGTCCTAAGGGGTTCGGGGAAGG - Intronic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989700002 5:44252627-44252649 GTTTTTAAGGGGATCATTGAGGG + Intergenic
990085269 5:51968851-51968873 GTTTCTAAGGGAACCATGGAGGG + Intergenic
990191324 5:53263377-53263399 GTTCCTAAGGGCAAGATAGATGG - Intergenic
992172595 5:74119181-74119203 GTTTCTAAGAATATCATGGATGG - Intergenic
994937549 5:106273985-106274007 GTCTTTAAGGGTATCATGGAGGG + Intergenic
995494743 5:112729382-112729404 GTTGATAAGGTGATCATGGAAGG + Intronic
996276185 5:121668725-121668747 GTTTTTAAGGGGATCGTGGAGGG + Intergenic
999686833 5:154110723-154110745 ATTCCTCAGGGGTTCAGGGATGG + Intronic
1000654496 5:163859925-163859947 GTTCCTAAGGAGCTGATGTATGG + Intergenic
1002304618 5:178275869-178275891 GTGTTTAAGGGGATCATGGAGGG - Intronic
1004616800 6:17298456-17298478 GCCACTTAGGGGATCATGGAGGG + Intergenic
1006084553 6:31586873-31586895 GCTGGTAAGGGGATGATGGAGGG - Intronic
1010400987 6:75445484-75445506 TTTCCTAAGGAAATCAGGGAAGG - Intronic
1011969836 6:93209484-93209506 TTTCAAAAGGAGATCATGGAAGG - Intergenic
1014507436 6:122276875-122276897 GTTCTTAAGAGTATCATGAACGG - Intergenic
1014574904 6:123057863-123057885 TCTCCTAAGGGGTTCATGGATGG + Intronic
1016276160 6:142355406-142355428 ATTCTAAATGGGATCATGGAAGG + Intronic
1017358695 6:153541317-153541339 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1017358936 6:153543202-153543224 GGTTTTAAGGGGATCATGGAGGG - Intergenic
1019553194 7:1614167-1614189 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1021224743 7:18013923-18013945 GTTTTTAAGGGAATCATGGAGGG + Intergenic
1021664949 7:22967958-22967980 GTTCCTAAAGGGAAGAGGGATGG - Intronic
1026286037 7:68963581-68963603 TTTTATAAGGGGATCCTGGAGGG + Intergenic
1026556092 7:71409854-71409876 GCTTTGAAGGGGATCATGGAAGG + Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027250916 7:76398132-76398154 GTTCCTCAGGAGATCAGGGAAGG - Intronic
1028173148 7:87623545-87623567 GTTCCAGAGAGCATCATGGAAGG - Intronic
1029900544 7:104034763-104034785 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1030846654 7:114423187-114423209 GTTACCAAGGGTATAATGGATGG - Intronic
1031017846 7:116594960-116594982 TTTCCTAACGAGATCATGAATGG - Intergenic
1033244881 7:139709510-139709532 GTTGATCAGGGGATCATGGAGGG + Intronic
1033281286 7:140008389-140008411 GCTCCAAAGGAGATCAGGGAAGG - Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034925740 7:155120062-155120084 GGTTTTAAAGGGATCATGGAGGG - Intergenic
1035355851 7:158275841-158275863 GTCCCTGAGGGGCTGATGGAGGG - Intronic
1038525881 8:28272885-28272907 GTTTTTAGGGGGATCATGGAGGG + Intergenic
1040936911 8:52791003-52791025 GTTTTTAAGGAAATCATGGAGGG + Intergenic
1040974052 8:53170332-53170354 ATTTTTAAGGGGGTCATGGATGG - Intergenic
1040985572 8:53290630-53290652 GTTTTTAAGGAGATCATGAAGGG + Intergenic
1041055536 8:53982180-53982202 GTTCCTAATGGCATCTAGGATGG - Intronic
1041936763 8:63340612-63340634 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1045797192 8:106060056-106060078 GTTTTTAATGGGATCATGGAGGG - Intergenic
1046302234 8:112311003-112311025 CTTCCTATGGGTATCATGCATGG - Exonic
1046470138 8:114661912-114661934 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1048893825 8:138970878-138970900 GTTTTTAAGGGGACCATGGAGGG + Intergenic
1049482709 8:142834587-142834609 TTTCCTAAAGGGAGCGTGGATGG + Intronic
1049864109 8:144922504-144922526 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1050685166 9:8160235-8160257 GTTCCTAAGATGATTATTGATGG - Intergenic
1051064519 9:13086401-13086423 GTTCTTAAGGGCATCAAGAATGG - Intergenic
1051126794 9:13813966-13813988 TTCCCTAAGGGGTCCATGGATGG - Intergenic
1051217856 9:14817815-14817837 GTGCGTGAGAGGATCATGGAGGG - Intronic
1052240162 9:26261957-26261979 GTTTTTAAGGAGATCATGGAGGG + Intergenic
1057287697 9:93773488-93773510 ATTTTAAAGGGGATCATGGAGGG + Intergenic
1058327702 9:103718757-103718779 ATTTTTAAGGGGATCATTGAGGG + Intergenic
1061091599 9:128429499-128429521 GTTCCTCGGGGGAACATGGCTGG - Intronic
1061863968 9:133482582-133482604 GCTTTTAAGGGGATCATGGAGGG + Intergenic
1186189295 X:7053303-7053325 GTTCCCAAAGAGATAATGGAAGG + Intronic
1187473387 X:19588908-19588930 TTTCTGAAGGTGATCATGGAAGG + Intronic
1189906281 X:45763356-45763378 GTTCCTAAAGGGATTTTGGAAGG + Intergenic
1189933674 X:46041741-46041763 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1192178830 X:68902825-68902847 GTTCCTAAGGGCAACACAGAGGG + Intergenic
1192324308 X:70119204-70119226 GTTTCTAAGGGGATCATGGAGGG + Intergenic
1195963528 X:110409562-110409584 GATCCTAATGGGGGCATGGAGGG - Intronic
1199619102 X:149683400-149683422 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1200513130 Y:4105213-4105235 GTTCCAAGGAGTATCATGGAAGG + Intergenic
1201567873 Y:15385403-15385425 GTTCCCAGGGGGTTCATGGGAGG + Intergenic
1201595235 Y:15660761-15660783 GCTTTTAAGGGGATCGTGGAAGG + Intergenic