ID: 944973987

View in Genome Browser
Species Human (GRCh38)
Location 2:205026297-205026319
Sequence CAGGGTGGCTGCAGTGTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 444
Summary {0: 1, 1: 0, 2: 7, 3: 38, 4: 398}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944973987 Original CRISPR CAGGGTGGCTGCAGTGTAGT GGG Intronic
900943266 1:5814777-5814799 AAGGGTGGCTTCTGTGTAGGTGG - Intergenic
901718575 1:11176656-11176678 CAGGGTGGCCTCAGTGTGGCTGG - Intronic
902286867 1:15412722-15412744 TTGGGAGGCTGCAGTGTGGTTGG + Intronic
902539711 1:17145540-17145562 CAGCGTGGCTGGAGAGAAGTGGG - Intergenic
902961170 1:19963713-19963735 CAGAGTGGCTGGAGTGAAGCGGG - Intergenic
903320560 1:22540658-22540680 CAGGGTGGCTGGAGCAGAGTGGG + Intergenic
904573230 1:31483749-31483771 CCTGGTTGCTGCAGTGTAGGGGG + Intergenic
904861399 1:33540774-33540796 CTAGGTGGGTGCAGGGTAGTCGG - Intronic
904973214 1:34435175-34435197 CCAGGTGGCTTCCGTGTAGTTGG - Intergenic
905572474 1:39016760-39016782 CAGGGTGTCTGCAAGGTTGTAGG - Intergenic
905721489 1:40206719-40206741 CAAGGCGGCTGGAGAGTAGTGGG - Intronic
906321243 1:44818249-44818271 CAGGATGGCAGCAGTGGAGGTGG + Intergenic
906811948 1:48836099-48836121 CAGGGTGGTGGCAGTGGAGATGG + Intronic
907869196 1:58427514-58427536 CAGGGTGGCAGCAGTGCAGCTGG + Intronic
908118946 1:60967600-60967622 CAAGGAAGCTGCAGTGTGGTAGG + Intronic
908828003 1:68151994-68152016 TAGGGTGGCAGCAGTGGAATTGG + Intronic
909180164 1:72413761-72413783 CATGGTGGCTGGACTATAGTGGG + Intergenic
909502644 1:76353175-76353197 CAGGGTGGCTGGAGAGGAGATGG - Intronic
912358405 1:109074043-109074065 CAGGGTGGCGGCAGGGCAGAGGG - Intronic
912916822 1:113823842-113823864 CATGATGGCTGAAGTATAGTTGG - Intronic
915268047 1:154732678-154732700 CTGGGTGGCTGCACAGCAGTGGG + Intronic
915462116 1:156076527-156076549 CAGGGTGGGCCCAGTGGAGTGGG + Exonic
916268883 1:162919267-162919289 CGGGGCGGCTGCACTGTACTGGG + Intergenic
916573695 1:166048970-166048992 CAGTGTGGCTGGAGTGGAATAGG - Intergenic
916671958 1:167029765-167029787 CGGGGTGGCTGCCGGGTAGAGGG - Intergenic
917029326 1:170671758-170671780 CAGGGTGGCAGGAGGGGAGTGGG + Intronic
917793416 1:178514317-178514339 CTGAGTGGCTGCCGTGGAGTGGG + Intronic
918068739 1:181119577-181119599 CAGGGTGGCTGCAGGGGATCTGG + Intergenic
918180388 1:182081920-182081942 CAGGATGGCTGGAATGTAGCAGG + Intergenic
918319974 1:183355067-183355089 CAGCATGGCTACAGTGCAGTGGG - Intronic
918649632 1:186945252-186945274 CCGTGTGGCTGAAGTGAAGTGGG + Intronic
919220759 1:194625302-194625324 CAGGGTTGCTGCAGTTTGCTGGG - Intergenic
920793412 1:209114535-209114557 CAGGGAGGGTGCAGTGAAGGAGG - Intergenic
921880927 1:220253391-220253413 TAGGGTTGCTGCAGTTTACTGGG - Intronic
923209048 1:231786821-231786843 AAGGGTGGACGCAGTGCAGTGGG - Intronic
923271255 1:232357161-232357183 CGGGGTGGCTGCAGTGGAGGTGG + Intergenic
923978589 1:239294501-239294523 CAGGGTGGTGACAGTGGAGTAGG - Intergenic
924463634 1:244281516-244281538 CAGGATGGGTGGAGTGCAGTGGG - Intergenic
1062760429 10:12969-12991 CAGGGTGGGCGCTGTGCAGTGGG - Intergenic
1063615013 10:7593500-7593522 CTGGGTGGCTGCAGTCTACAGGG - Intronic
1064370372 10:14747554-14747576 TAGGGTGGCTGCAGTTTGCTGGG + Intronic
1064490437 10:15850319-15850341 CAGGATGGCTGCAGTGTTCAGGG + Intronic
1065754727 10:28920623-28920645 CACAGTGGCTGCAGTGTGTTGGG + Intergenic
1065878883 10:30022376-30022398 CATGGGGGCAGCAGTGCAGTGGG + Intronic
1066231224 10:33435752-33435774 CAGGGTGGTTGCAGGGTGGAGGG - Intergenic
1068572571 10:58646489-58646511 CAGGCTGTCTGCATTGTATTTGG + Intronic
1068603769 10:58982677-58982699 CAGGGAAGCTGGAGTGTATTAGG + Intergenic
1069605022 10:69733396-69733418 CAGTGTGGCTGGGGTGTAGTTGG + Intergenic
1069954683 10:72042734-72042756 CAGGGGGGCTGCCATGAAGTTGG + Intergenic
1071151126 10:82635826-82635848 CAGGGAGGCTGCAGTGGACTAGG + Intronic
1072454010 10:95560920-95560942 CAGGGTGGCTGCAATTTGGGTGG - Intronic
1074425663 10:113349053-113349075 CAGCGTGGCTGTAGTGTAAGAGG + Intergenic
1075809421 10:125214180-125214202 CAGCTTGACTGCAGTGTTGTTGG - Intergenic
1076933096 10:133546814-133546836 CAGGGTTGCTGCAGTTTGCTGGG - Intronic
1076987678 11:251072-251094 CAGGGTGGTGGCAGTGGGGTGGG - Intronic
1077350938 11:2092924-2092946 CAGGGTGGCTGCAGAGGGGATGG - Intergenic
1077984779 11:7340908-7340930 CAGGGCTGCTGCAGTGTGCTGGG + Intronic
1078037755 11:7825223-7825245 CAGAGTGACTGCAGTGAGGTGGG + Exonic
1078069048 11:8096375-8096397 TAGGGTGGCTGCTAGGTAGTGGG + Intronic
1078210135 11:9264278-9264300 AAGGGTAGCAGCATTGTAGTTGG - Intronic
1078437940 11:11340866-11340888 CAGGGTGGCTGAAGTCTGGATGG - Exonic
1079476900 11:20840602-20840624 CAAGGTGGCCTCAGGGTAGTTGG + Intronic
1080765918 11:35296636-35296658 TAGAGAGGCTGCAGTGTGGTTGG - Intronic
1080865521 11:36191153-36191175 CAGGGTGGCGGCTGTGTATCAGG + Intronic
1082080786 11:48011014-48011036 CAGGGTGGGTGCACTGTTCTAGG + Intronic
1082568971 11:54714558-54714580 GAAAGTGGGTGCAGTGTAGTGGG - Intergenic
1082870325 11:57938455-57938477 CAGGGAGTCTGCAGTATAGCCGG + Intergenic
1083001379 11:59294618-59294640 CAGGCTGGCTGGAGTGTAGTGGG + Intergenic
1083244784 11:61418352-61418374 CAGGGTGGCTGCACTTTATGAGG + Intronic
1084434820 11:69132552-69132574 CAGGGAGGCTGGAATGGAGTTGG - Intergenic
1085057078 11:73411326-73411348 CAGCCTGGGTGCAGTGTGGTGGG - Intronic
1085814974 11:79727841-79727863 CAGGGATGCTGCAGTGTGGGAGG + Intergenic
1086922693 11:92605352-92605374 CAGGTGGGCTGCAGTGTGATGGG + Intronic
1087222069 11:95557287-95557309 CAGGGAGGGTGCAATCTAGTTGG + Intergenic
1089115209 11:116089401-116089423 AAGGGTGGCTACAGAGAAGTGGG + Intergenic
1091574647 12:1721878-1721900 CAGTGTGGCTGGAATGTAATGGG + Intronic
1091744360 12:2981774-2981796 CAGGGGTGCTGGAGGGTAGTGGG + Intronic
1092856023 12:12674432-12674454 CAGGGTGATGGCAGTGTAGGTGG + Intronic
1093493186 12:19726890-19726912 TTGGGTGGCTGCAGTGTACCTGG + Intergenic
1094382348 12:29856346-29856368 CAGGGTGGAAGCTGTGCAGTTGG + Intergenic
1095577439 12:43757015-43757037 CAGAGTAGCTGGAGTATAGTGGG - Intronic
1097086421 12:56471707-56471729 CATGGTGGCTGGAGGGTAGGTGG + Exonic
1097156637 12:57016613-57016635 CAGGGTGGCTGGAGGGGAGGCGG + Intronic
1097637214 12:62137653-62137675 CAGGGTGGTTGGAGTGGAGGTGG - Intronic
1098236718 12:68424689-68424711 CAGGGTGGCAGCAGTAGAGGAGG + Intergenic
1098281997 12:68871291-68871313 CAGGTAGCTTGCAGTGTAGTGGG + Intronic
1099254613 12:80300393-80300415 CTGGGTGGCTGCAGAGAAGCAGG + Intronic
1100815034 12:98378678-98378700 CAGTGTGGGTGAAGTGAAGTGGG - Intergenic
1100925794 12:99546861-99546883 CAGGGTACATGCAGTGTAGCAGG + Intronic
1101592862 12:106139097-106139119 CCGGGTGGCTGCAGGGAGGTGGG - Exonic
1101718904 12:107334307-107334329 CAGGGTGGTAGCAGTGGAGGTGG + Intronic
1102311097 12:111844887-111844909 CAAGGTGGCTGGAATGCAGTGGG + Intronic
1102459084 12:113089203-113089225 CAGGGTGGCTGGAGTGGAGTGGG + Intronic
1102516085 12:113447819-113447841 CAGGGTGGCTGCAGGGAAGAGGG + Intergenic
1103399303 12:120632081-120632103 CACGGTGGCTGGAATGTGGTGGG + Intergenic
1104732706 12:131116833-131116855 CAGGGTGGCTGCACTAGAGCAGG + Intronic
1105402039 13:20104745-20104767 CAGGCTGGCTGCAGAGTAAGGGG + Intergenic
1105603687 13:21909691-21909713 CACGCTGGCTGCAGTGTGGGTGG + Intergenic
1105787055 13:23759863-23759885 CACAGTGGCTGCAGGGTAGGGGG + Intronic
1106044877 13:26129639-26129661 CAGTGTGACTGCTGTGTAGAGGG - Intergenic
1111971671 13:94923486-94923508 GATGGTGGTTGCAGTGTAGTTGG - Intergenic
1116877204 14:50123837-50123859 CAGGGTGGCAGCAGTGGAGATGG + Intronic
1118130331 14:62955976-62955998 CAGGAAGGCTGCAGCGTGGTTGG - Intronic
1119331377 14:73796628-73796650 CAGGGTGGCCCCACTGCAGTTGG - Intergenic
1119999622 14:79288215-79288237 CAGCGTGACTGCACTGAAGTTGG - Intronic
1120106600 14:80502355-80502377 CAGGATGGCTGCTGTGCAGTGGG + Intronic
1120547586 14:85829856-85829878 CAGGGTGGCTGCTGGGCAGAGGG + Intergenic
1121133504 14:91472502-91472524 CAGGCTGGATGGAGTGCAGTGGG + Intronic
1122010444 14:98742011-98742033 AAGGGTGGCAGGAGTGTGGTTGG - Intergenic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122122010 14:99559754-99559776 CAGGGTGGCTGCAGACTAAGAGG + Intronic
1122267583 14:100553935-100553957 CAGGGTGACTTCAGTGGAGCAGG + Intronic
1122988058 14:105221700-105221722 CAGGCTGGCTGCAGTGGGGAGGG + Exonic
1123185259 14:106510613-106510635 CAGGATGGCTGTAGTGGAGGAGG + Intergenic
1123493959 15:20804803-20804825 CATGGTGGCTGCCGTGCCGTGGG + Intergenic
1123550458 15:21373885-21373907 CACGGTGGCTGCCGTGCCGTGGG + Intergenic
1124002293 15:25769546-25769568 CCGGCTGGCTGCAGTGTTCTAGG - Intronic
1124545851 15:30626135-30626157 CCGGGTGTCTGCAGTGGAGCTGG + Intronic
1124805538 15:32878226-32878248 CCGTGTGGCTGGAGTTTAGTGGG + Intronic
1125807483 15:42506278-42506300 CAGGCAGGCTGGAGTGTAGTGGG + Intronic
1125887246 15:43238139-43238161 CAGGGTGGCTGAAGGGCGGTGGG - Intronic
1126343250 15:47666898-47666920 CATGGTGGCCTCAGGGTAGTTGG - Intronic
1126804173 15:52329333-52329355 CAGGGTGACAGCAGTGTGATTGG - Intronic
1127016650 15:54696165-54696187 CAGTTTGGCTGCAGCATAGTTGG - Intergenic
1127403008 15:58610471-58610493 CAGGGTCTGTGCAGTGGAGTAGG - Exonic
1128285641 15:66434851-66434873 CCGGGTGGCTGGAGTGAAGTGGG + Intronic
1128506489 15:68276814-68276836 CAGTGTGGCTGCAGCAGAGTGGG - Intergenic
1128831304 15:70771881-70771903 CAGTGTGGCTGGAGCATAGTGGG + Intergenic
1129110265 15:73333133-73333155 GTGGGGGGCTGCAGTGTAGCTGG + Intronic
1129347810 15:74935247-74935269 CATGCAGGCTGCAGTGCAGTTGG - Intronic
1129454080 15:75667257-75667279 TAGGGTGACTGCTGTGTAATTGG + Intergenic
1130137380 15:81192802-81192824 GAGGGTGGCGGCAGTGAAGATGG + Intronic
1130356089 15:83131590-83131612 CACCCAGGCTGCAGTGTAGTGGG - Exonic
1132008440 15:98252575-98252597 CAGCTTGGTTGCAGTGCAGTGGG - Intergenic
1132265913 15:100470515-100470537 CAGAGTGACTGTAGTGGAGTGGG + Intronic
1202958801 15_KI270727v1_random:101139-101161 CATGGTGGCTGCCGTGCCGTGGG + Intergenic
1132845769 16:2000163-2000185 CGGGGTTGCTGCAGTGGAGCAGG + Exonic
1132864577 16:2087116-2087138 CTGGGTGGGCACAGTGTAGTTGG + Intronic
1133297168 16:4760227-4760249 CAGGGAAGCTGAAGTGAAGTAGG + Intronic
1133417279 16:5616479-5616501 CACGGTGGCAGCAGTTCAGTGGG - Intergenic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1134205296 16:12232726-12232748 CAGGATGGCTGCAGCCTAGAGGG + Intronic
1134739205 16:16527590-16527612 CAGGGCAGCTGAAGTGGAGTGGG - Intergenic
1134928295 16:18184561-18184583 CAGGGCAGCTGAAGTGGAGTGGG + Intergenic
1135137400 16:19895228-19895250 CAGGGTGGCTGCCATGCAGGAGG + Intergenic
1136035283 16:27534645-27534667 CAGGGTGGCAGCTGTGGGGTAGG - Intronic
1137633529 16:49965808-49965830 CCGGGTGGCTGCAGTCTACATGG + Intergenic
1137875179 16:51989873-51989895 CAGGGTGGCTGGGGTGTGCTGGG + Intergenic
1138124372 16:54426754-54426776 CATGGGGGCTGCAGTGTTGGTGG + Intergenic
1140420584 16:74815756-74815778 CAGGGTGGCCGCAGTGGAAGTGG + Intergenic
1142405126 16:89884273-89884295 CAGGGTGGCTGCAGTGTGGCAGG + Intronic
1142473145 17:174358-174380 CAGTGTGCCTGCGGTGTAGGAGG + Intronic
1143272828 17:5688520-5688542 GGGCGAGGCTGCAGTGTAGTTGG + Intergenic
1143431476 17:6890555-6890577 GAGGCTGGCAGCAGTGTAGCTGG - Intronic
1143580419 17:7822344-7822366 CTGCGTGGCTGGAGTGGAGTGGG - Intronic
1143861894 17:9897268-9897290 CGGGGTGGCTGGAGGGTAGAAGG - Exonic
1145086595 17:19947177-19947199 CAGATGGGCTGCAGTGTAGCGGG - Intronic
1145265680 17:21378574-21378596 GAGGGTGGCTCCAGTGTGCTGGG + Intronic
1145791870 17:27632479-27632501 CAGGGTGGCTGAGGTGTCATTGG - Intronic
1145916328 17:28576166-28576188 CAGTGGGGCTGCAGTGATGTAGG + Intronic
1147946869 17:44085275-44085297 CAGGGTGGCTGCAGTGGCCATGG - Intronic
1148678248 17:49457528-49457550 CATGGAGCCTGCAGTGTAATGGG + Intronic
1148871672 17:50662118-50662140 CAGGGTGGCTGGATGGAAGTGGG + Intronic
1150240180 17:63624700-63624722 CCTGGTGGCTGCAGTATATTAGG + Intronic
1151487554 17:74410744-74410766 CAGGGTGGCTGGGGTAGAGTGGG + Intergenic
1151653168 17:75482460-75482482 CAGGCTGGATGCAGTGGCGTGGG - Intronic
1152144380 17:78559506-78559528 CAGAGTGGCAGCAGTGAAGGTGG - Intronic
1152277038 17:79363911-79363933 CAGGGTGGCTGGAGTGGAGTGGG - Intronic
1152539906 17:80969616-80969638 CAGGGTGGCCCCAATGCAGTAGG + Intergenic
1152953337 18:13323-13345 CAGGGTGGGCGCTGTGCAGTGGG - Intergenic
1154451480 18:14479265-14479287 CATGGTGGCTGCCGTGCCGTGGG + Intergenic
1156327138 18:36085096-36085118 AAGGGTGGGGGCAGTGCAGTTGG - Intergenic
1156482519 18:37445204-37445226 CAGGGTCTCTGAAGTGTGGTGGG - Intronic
1158647997 18:59264654-59264676 CAGGGTGGTCCCAGTTTAGTTGG + Intergenic
1160043762 18:75368607-75368629 CAAGGTGGCTGCAGTGGTGCTGG - Intergenic
1162566296 19:11447194-11447216 CGGGGTGGGGGCAGTGTGGTGGG - Intronic
1165467489 19:35983656-35983678 CAGGGTGGCTGCAGTGCACTGGG - Intergenic
1165707858 19:37989077-37989099 CACGGTGCCTGCCGTGTAGGAGG + Intronic
1165891235 19:39113502-39113524 CAGTGTGGCTGCAGCAGAGTGGG - Intergenic
1166066366 19:40361566-40361588 CAGTGTGTCTGCAGTGAAGTGGG - Intronic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
1166365090 19:42274183-42274205 CAGGGTGCCTGCTGTGCAGCGGG + Intronic
1167079135 19:47267317-47267339 CAGGCTGGATGGAGTGCAGTGGG + Intronic
1167216685 19:48170137-48170159 CGGGGTGTCTGCAGAGGAGTGGG - Intronic
1167658214 19:50780193-50780215 CCGCGTGGCTGCAGAGTTGTAGG + Intergenic
1168355412 19:55696917-55696939 CAGGGTGTCTGGAGGGTTGTCGG + Intronic
925094229 2:1182629-1182651 CAAGGTGCCTGCAGTGAAGTAGG + Intronic
925395596 2:3531363-3531385 CAGGGTGGCAGCAGAGTTTTAGG - Intergenic
925663085 2:6223397-6223419 CAGGGTCCCTGCAGTGCAGAGGG - Intergenic
926344737 2:11934980-11935002 TAGGGTAGCAGCAGTGTGGTAGG + Intergenic
929527802 2:42722066-42722088 CAGGGTGGCTTGTGTGTAGTTGG + Intronic
930633960 2:53785013-53785035 CAGTGTGGCTGGAGTGTAAGAGG - Intronic
931366885 2:61626978-61627000 CAGGGAGCCTGCAGTCTGGTAGG - Intergenic
931629650 2:64287267-64287289 TAGAGTGGCTGCTGTGTACTTGG + Intergenic
932028188 2:68156992-68157014 CAGGATGCCTGCAGTGTGGTTGG - Intronic
932522222 2:72426941-72426963 GAGGGTGGCAGCAGTGCATTTGG - Intronic
933436444 2:82256544-82256566 TAGGGTGGCTGCAGTTTGCTGGG + Intergenic
934557187 2:95293707-95293729 CAGGCTGGCTGCATTGAAGGCGG + Intergenic
934791593 2:97067023-97067045 CAGGGTGGATGCAGAGTGGAGGG - Intergenic
934937129 2:98473513-98473535 CAGTGTAGGTGCAGTGTAGAGGG + Intronic
935719997 2:105971652-105971674 GAGGGTGGCGGGAATGTAGTTGG + Intergenic
935760581 2:106316888-106316910 CAGGGTGCCTGGAATATAGTAGG + Intergenic
936295021 2:111261378-111261400 CAGGGTGGATGCAGAGTGGAGGG - Intergenic
936381204 2:111988107-111988129 CAGGGAAGCTGCAGTGTACTTGG + Intronic
936400660 2:112162087-112162109 CTGGGAGGCTGCAGTGAACTAGG - Intronic
936490025 2:112961952-112961974 CATGGTGGCCACGGTGTAGTTGG + Intergenic
938798842 2:134741296-134741318 CAGGGTGGCTGGAGTATGGTGGG + Intergenic
941173306 2:162165711-162165733 CAGGGTGGCTGTAGTTTGATAGG + Intergenic
941732523 2:168934238-168934260 CTGGGTGGGTGTAGTGGAGTGGG + Intronic
941771457 2:169350044-169350066 CAGGGTGGCAGAAGTGAAGATGG + Intronic
941786627 2:169505750-169505772 CAGGGTGGCTGCTGGGCAGAGGG - Exonic
942324988 2:174768953-174768975 CAGAGTGGTTGCAGTGAAGGTGG + Intergenic
942559257 2:177202908-177202930 CACCCAGGCTGCAGTGTAGTAGG - Intergenic
943191807 2:184686325-184686347 GATGTTGGCTGCAGTGTAGGAGG - Intronic
943411726 2:187556692-187556714 CAGGGTGGCTGCTGGGCAGAGGG - Intronic
943448221 2:188016372-188016394 CATGGTAGCTGCAGTGCAGCAGG - Intergenic
943473793 2:188329519-188329541 CTGGGTGGCTGAAATGAAGTGGG + Intronic
943769187 2:191696494-191696516 CGGGGTGAATGCACTGTAGTAGG - Intronic
944973987 2:205026297-205026319 CAGGGTGGCTGCAGTGTAGTGGG + Intronic
945136944 2:206639624-206639646 AAGGGTGGCAGCAGTGGAGAGGG - Intergenic
945316663 2:208377616-208377638 CAGGGTGGCTGCTGGGCAGAGGG + Intronic
947288286 2:228542857-228542879 CAGTGTGTCTGCAGTGAACTGGG - Intergenic
947446951 2:230171563-230171585 CAGCGTGGCAGCAGTGGAGCGGG - Intronic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948807118 2:240457806-240457828 CAGGGTGGCTGGAATGCAGCAGG - Intronic
1169005526 20:2204144-2204166 CAGTGTGGCTGGAATGAAGTGGG - Intergenic
1169088835 20:2844836-2844858 CAGTGTGGCTGGAGTGCTGTAGG + Intronic
1170795943 20:19546768-19546790 CAGGGTGACTGCAGTGGTCTAGG - Intronic
1171952863 20:31437055-31437077 CAGCGTGGCTGAAGAGTAGTGGG + Intergenic
1172910868 20:38407801-38407823 CGGGGTGGCTGCCGGGCAGTGGG - Intergenic
1173343369 20:42175302-42175324 CAGTGTGGCTGCAGCCTAGAGGG - Intronic
1173897528 20:46562300-46562322 TGGGGTGGCTGCAGTGGAGTTGG - Intronic
1174392202 20:50224605-50224627 CAGGGGTGGTGCAGTGGAGTGGG - Intergenic
1175530723 20:59672855-59672877 CAGGGTGGCTCCTGTGGAGGTGG + Intronic
1176444664 21:6810964-6810986 CATGGTGGCTGCCGTGCCGTGGG - Intergenic
1176977092 21:15334710-15334732 CAGGGTTGCTGCAGTATGTTGGG + Intergenic
1177157380 21:17513110-17513132 CATGGTGGCTGCCGTGCCGTGGG - Exonic
1177326905 21:19602354-19602376 AAGTGTTGCTGCAGTGTAGATGG + Intergenic
1178764765 21:35439969-35439991 CAGGGGAGCTGGAGTGTGGTAGG - Intronic
1179144419 21:38754709-38754731 GAGGGTGCCTACAGTGGAGTTGG - Intergenic
1179320999 21:40291186-40291208 CAGGGTGACTGCAGTGGAGGAGG - Intronic
1179726159 21:43342212-43342234 CATGGTGGCTCCAGTCTGGTGGG - Intergenic
1181671444 22:24427343-24427365 CAGGGTGGCTGCAATGAGGATGG - Intronic
1182087394 22:27570738-27570760 CAGCGTGGCTGGAGTGGAGTGGG - Intergenic
1182554774 22:31123180-31123202 CAGGGAGCCTGCAGTGTATGTGG - Intronic
1183510064 22:38229544-38229566 CTGGGTGGGGGCAGTGTGGTGGG - Intronic
1183875116 22:40773658-40773680 CAGGGTGACTGAAGTATAGAAGG + Intronic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1184376637 22:44117495-44117517 CGGGGTGGAAGCAGGGTAGTTGG + Intronic
1184830762 22:46984907-46984929 CAGGGAGGCGACAGGGTAGTTGG + Intronic
1184841921 22:47057098-47057120 CAGGCTGAATGCAGTGTTGTTGG + Intronic
1185012656 22:48323925-48323947 CAGGATGGCTGCTGTGAAGGTGG - Intergenic
1185330436 22:50249829-50249851 CAGGCTGGCTGCAGGGGGGTGGG - Intronic
950129852 3:10534491-10534513 CAGAGTAGCTGGAATGTAGTAGG - Intronic
950284760 3:11735906-11735928 CAGCGTGGCTGCAGTGGGGTTGG + Intergenic
954229242 3:49203572-49203594 CAGGCTGGTGGCAGTGGAGTAGG + Intronic
954965235 3:54604656-54604678 CAGGGTGAGAGCAGTGGAGTGGG - Intronic
954975822 3:54693343-54693365 CAGGATGGCTGCAGCCTAGGTGG - Intronic
955926644 3:64012643-64012665 CAGGGTGGCTCCAGCATAGTTGG - Intronic
955953360 3:64263985-64264007 CAGAGTGGCGGCAGGGCAGTGGG + Intronic
957151888 3:76497066-76497088 CATTGTGGCTGGAGTGCAGTGGG - Intronic
959029707 3:101283999-101284021 CAGGGTGGTGGCAGTGAAGATGG + Intronic
960430546 3:117563310-117563332 CAGTCTGGCTGGAGTGCAGTAGG + Intergenic
960676314 3:120198802-120198824 CTGTGTGGCTGGAGTGGAGTGGG - Intronic
962486182 3:135844866-135844888 CAGGGTGGCAGCAGTGGAAGTGG + Intergenic
962652196 3:137507906-137507928 CAGAGTGGGTGCCATGTAGTAGG + Intergenic
962714600 3:138115537-138115559 CAGGTTGGCGGCACTGGAGTGGG - Exonic
963180358 3:142348991-142349013 CACTGAGGCTGCAGTGCAGTGGG + Intronic
963922991 3:150923933-150923955 AAGGGTGACTGCAGAGGAGTAGG + Intronic
966454866 3:180102989-180103011 TAGGGTTGCTGCAGTGTGCTGGG - Intergenic
966891429 3:184410147-184410169 CACTGTGGCTGGAGTGCAGTGGG - Intronic
967129556 3:186458166-186458188 CAGTGTGGCTGAATTGTTGTTGG + Intergenic
967143765 3:186587958-186587980 CAGGCTGGCTGCATTGTTGGAGG - Intronic
969131598 4:4994672-4994694 CTGTGTGGCTGCATTGTGGTGGG + Intergenic
969340357 4:6536629-6536651 CAGGGTGGGTGCAGTGGAGAAGG + Intronic
969346222 4:6571820-6571842 CATGGTGGCCTCAGGGTAGTTGG + Intergenic
969411279 4:7029967-7029989 CAGGGTGGCAGGAGTGCAGCGGG + Intronic
969666579 4:8560766-8560788 CAGGCTGGCTGCAGAGTCCTGGG - Intronic
969988052 4:11231883-11231905 CAGGGTGTCTGAAGTGCAGTGGG - Intergenic
972337825 4:38123620-38123642 CAGGGTGGCCGCAGGAAAGTGGG - Intronic
972420651 4:38883183-38883205 CAGGATGCCTACAGTCTAGTTGG + Intronic
972694624 4:41433600-41433622 CATGGTGGTTTCAGGGTAGTTGG + Intronic
972938483 4:44168065-44168087 CAGGGTGGCGGCAGGGCAGAGGG - Intergenic
973047710 4:45555072-45555094 CATGATGTCTTCAGTGTAGTCGG + Intergenic
975729183 4:77320971-77320993 GAGGGAGGCTGCACTGTTGTTGG - Intronic
975810890 4:78168434-78168456 CAGGGGTGCTGCAGGGAAGTGGG - Intronic
976035877 4:80820514-80820536 CAGTGTTGCTGGAGCGTAGTGGG + Intronic
976274082 4:83258312-83258334 CAGGGTGGCAGCTGTGGAGGTGG + Intergenic
976798633 4:88962534-88962556 CAGGGAGGCTCCAGAGTGGTGGG + Intronic
978193663 4:105945632-105945654 CAGGGTGGTAGCACTGGAGTTGG - Intronic
978807143 4:112812432-112812454 CATGGTGGCTTCAGGGTGGTTGG - Intergenic
979097030 4:116563568-116563590 CAGGGTGGCTGTAGTTTGCTCGG - Intergenic
980626389 4:135380120-135380142 TAGGGTTGCTGAAGTGTATTGGG + Intergenic
981335210 4:143561773-143561795 CACCATGGCTGGAGTGTAGTGGG + Intergenic
982178813 4:152731228-152731250 CAAGATGGCTGCAGTGGAGCGGG + Intronic
984474498 4:180218613-180218635 CAGGGTGCCTGCTGTATAATAGG + Intergenic
984630299 4:182053565-182053587 CAGGGTGGCAGCTCTGTAGGAGG + Intergenic
985030779 4:185787131-185787153 CAAGGAGCCTGCAGTGTAGTAGG - Intronic
985576426 5:675431-675453 CACGGTGGGTGCAGTGTGGCTGG + Intronic
985969190 5:3361943-3361965 CAAGGAGGCTGCATTCTAGTGGG + Intergenic
986064569 5:4223050-4223072 CGGGGTGGCTGCAGTCCAGGTGG - Intergenic
986466802 5:8034181-8034203 CAGGGAGGCTGCAGCGGGGTTGG + Intergenic
987034167 5:14003800-14003822 CAGGGTGGCCTCAGGGCAGTGGG - Intergenic
987085168 5:14461268-14461290 CGGGGTGGCCGCACTGTCGTCGG - Exonic
988371383 5:30372333-30372355 CAGCGAGGCTGCAGTTTAGATGG + Intergenic
989453618 5:41615843-41615865 CAGGGTATCTGAAGTGTAGTGGG - Intergenic
990196063 5:53317778-53317800 CAGGGCGGCTTTAGTGCAGTTGG + Intergenic
990253900 5:53945023-53945045 CAGGGAGGCTGCATTCTTGTAGG + Intronic
990670399 5:58123139-58123161 CAGGGCAGCTGCAGTAGAGTTGG - Intergenic
991326557 5:65439842-65439864 CACCCAGGCTGCAGTGTAGTGGG + Intronic
991448090 5:66721957-66721979 CAGGGTAGCAGCAGTGCAGAAGG - Intronic
991934595 5:71789412-71789434 CAGGGTGGTAGCAGTGGAGATGG + Intergenic
994316020 5:98334248-98334270 CAGTGTGGCATCAGTGTACTAGG + Intergenic
995258212 5:110072162-110072184 CAGGGTTGCTGCAGTTTGCTGGG + Intergenic
996377743 5:122831441-122831463 CAGGCTGGCTGTAGGTTAGTGGG - Intergenic
997198005 5:131992444-131992466 CAGAGTGGCTGCACCGGAGTAGG - Intronic
997235547 5:132270213-132270235 CAGGCTGGCTGTGGGGTAGTGGG + Intronic
997696133 5:135862541-135862563 CAGGGTGTCCACAGTCTAGTGGG + Intronic
997888358 5:137652220-137652242 CATGGTGGCTGTACTGTATTTGG - Intronic
998430507 5:142065928-142065950 CAGGGAGCCTCCAGTTTAGTTGG + Intergenic
998915864 5:147010846-147010868 CAGGGTGGCAGCTGTAGAGTAGG - Intronic
999097076 5:148989225-148989247 CATGGTGGCTGGAATGTAATAGG - Intronic
999578624 5:153009002-153009024 CAAGGAAGCTGCAGTCTAGTTGG - Intergenic
999858489 5:155620549-155620571 CATGGAGGCTGCAGTTTGGTGGG + Intergenic
1001214786 5:169845457-169845479 CAGGGTGCCTGGCGTGCAGTGGG + Intronic
1001604312 5:172949010-172949032 CACCCAGGCTGCAGTGTAGTGGG - Intronic
1001915768 5:175558698-175558720 CAGGCTGGATGGAGTGCAGTGGG - Intergenic
1001975245 5:175993497-175993519 CAGTGTGGCTTGAGTGGAGTGGG - Intronic
1002242186 5:177850273-177850295 CAGTGTGGCTTGAGTGGAGTGGG + Intergenic
1002669687 5:180856606-180856628 CAAGGTGCCTGCAGACTAGTAGG + Intronic
1003279089 6:4676464-4676486 CAGGGTGGCTGATGAGTAGCTGG - Intergenic
1003302443 6:4896397-4896419 AATGGTGCCTGCCGTGTAGTCGG + Intronic
1003447523 6:6198589-6198611 CAAGGTGCCTGGTGTGTAGTGGG - Intronic
1004005229 6:11632031-11632053 CAGGGTGGCTGCTGAACAGTAGG + Intergenic
1004817633 6:19329880-19329902 CAGTGTGGCTGAAGTAGAGTGGG + Intergenic
1004942628 6:20576755-20576777 CAAGGTGGCTACAGTCAAGTGGG - Intronic
1007222937 6:40293418-40293440 CAGGGTGGCTGCAGTGGCTGGGG + Intergenic
1007246947 6:40469863-40469885 CAGGGTGTGTGCAGGGTAGAGGG - Intronic
1007291408 6:40789933-40789955 CAGGGTGCCTTCAGTCTAGCAGG - Intergenic
1007825884 6:44600320-44600342 CAGGGTGGATGCAGTGTAGGAGG - Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1009960900 6:70519570-70519592 CAGGGTGGCTGCAGTGGCTATGG - Intronic
1011722882 6:90177255-90177277 CAAGTAGTCTGCAGTGTAGTTGG - Intronic
1013267133 6:108511037-108511059 CTGGAAGGCTGCAGTGCAGTGGG - Intronic
1013473349 6:110485730-110485752 CAGTGTGGCTGGAGTGGAGCAGG - Intergenic
1015540111 6:134305317-134305339 CAGGCTGGCTGGAGTGCAGTGGG - Intronic
1015816898 6:137220005-137220027 CAATGTGGCTGCAGTGGAATAGG - Intergenic
1016123571 6:140373749-140373771 CAGGGTGGCTGCTGGGCAGAGGG + Intergenic
1017037247 6:150277840-150277862 CACGGTAACTGCAGAGTAGTTGG + Intergenic
1017410565 6:154163236-154163258 CAAGGTAGCTGTAATGTAGTGGG - Intronic
1018472079 6:164106340-164106362 CGTGGTGGCAGCAGGGTAGTTGG - Intergenic
1018766623 6:166938668-166938690 CAGAGTGGGTGCAGAGTATTGGG - Intronic
1018926585 6:168211064-168211086 CAGTGTGGCTGCATTGGAGATGG + Intergenic
1018940959 6:168308633-168308655 CAGGGTGGCTGGAGTACAGACGG - Exonic
1020022147 7:4875574-4875596 CAGGGTTGCTGCTGTGTGGCTGG - Intronic
1020261406 7:6532472-6532494 ATGGGGGGCTGCAGTGTATTGGG - Intronic
1022394067 7:29969997-29970019 CAGGGTGGTGGCAGTGGAGGTGG - Intronic
1023311628 7:38893198-38893220 CAATGTGGCTGTAGTGTAGAAGG - Intronic
1023759714 7:43453263-43453285 CAGGGTGGGAGCAGTGGAGGTGG + Intronic
1024230071 7:47357046-47357068 CACCCAGGCTGCAGTGTAGTTGG - Intronic
1024753521 7:52500021-52500043 CATGGTGGCTGCAGTGTGGAGGG - Intergenic
1025035674 7:55591334-55591356 CAGGGAGGCAGCAGTGGGGTGGG - Intergenic
1026031536 7:66798554-66798576 CAGGCCTGCTGCAGGGTAGTTGG + Intronic
1026114214 7:67482786-67482808 CAGGGTGGTAGCAGTGTGGGTGG - Intergenic
1028577734 7:92370783-92370805 CACTGTGCCAGCAGTGTAGTTGG + Intronic
1029796098 7:102896082-102896104 CAGAGTGGCTGGAGTAGAGTTGG + Intronic
1031555034 7:123164137-123164159 TATGGTGGCTGCAGTGAAATAGG + Intronic
1031697270 7:124873914-124873936 CAAGGTGGCTACAGTGAAGATGG + Intronic
1031895623 7:127345597-127345619 CAGTGTGGCTGCATTCGAGTGGG + Intergenic
1032411603 7:131697571-131697593 CAGTGTGGCTGAAGTGGAGTAGG + Intergenic
1032681887 7:134193784-134193806 CTGGGTGGCTGCTGTGTAGAGGG - Intronic
1036419930 8:8586045-8586067 CAGGGTGGTAGCAGTGGAGGTGG - Intergenic
1036913012 8:12774711-12774733 CACGGAGCCTGCAGTCTAGTGGG + Intergenic
1037829539 8:22179520-22179542 CAGGGTGGCTGCTGGTCAGTGGG + Intronic
1039166443 8:34686673-34686695 GAGGGCGGTTGTAGTGTAGTGGG + Intergenic
1039204903 8:35141388-35141410 CAGGGTGACGGCTGTGGAGTAGG - Intergenic
1041589331 8:59558813-59558835 AAGGGTGGCTGCAATGTACTGGG + Intergenic
1041677297 8:60548883-60548905 CAGGGTGGCTGCCGGGCAGAGGG + Intronic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1043370015 8:79580136-79580158 CAGGGAGGCTGCAGTGGAGCAGG + Intergenic
1044699936 8:94956714-94956736 CAGGATGGCAGCAGTGGAGGGGG + Intronic
1044804105 8:95987360-95987382 CAAGGTGGCTGGAGTGGAATGGG + Intergenic
1045008691 8:97938130-97938152 GTGGGTGACTGCCGTGTAGTTGG + Intronic
1045031224 8:98138321-98138343 CAGGGTGGCTGAAGTGTAGAAGG - Intronic
1045249628 8:100472686-100472708 CAGGGTGGATGGAGTTGAGTGGG - Intergenic
1045274573 8:100691471-100691493 CAGGCAGGCTGGAGTGCAGTGGG - Intronic
1046504583 8:115120872-115120894 CATGGTGGCTTCGGAGTAGTTGG + Intergenic
1047015971 8:120723880-120723902 CAGGGTGTTTCCAGTCTAGTGGG + Intronic
1047276862 8:123412354-123412376 CAGGGTGTAAGCATTGTAGTTGG - Intronic
1047818859 8:128495959-128495981 CAGGGTATCTGGAGTGTAGGAGG - Intergenic
1048252960 8:132882529-132882551 CAGGGTGGTTTCAGTGAAGGTGG - Exonic
1048974534 8:139663553-139663575 CAGAGTGGCTTCAGAGTAGCTGG - Intronic
1048975695 8:139671936-139671958 CATGGGGTCTGCAGTGCAGTGGG + Intronic
1050291393 9:4159052-4159074 CAGGCTAGCTGCAATGTACTCGG + Intronic
1050297263 9:4218240-4218262 CATGGTGGTTGCAGTGGAGATGG - Intronic
1051340664 9:16106899-16106921 GAGGGTGGCTCCAGGGTAGATGG - Intergenic
1052728273 9:32256562-32256584 CAGCCTGTCAGCAGTGTAGTGGG + Intergenic
1052758180 9:32563380-32563402 CAGGATGGCTGGAGTACAGTGGG + Intronic
1053025144 9:34723321-34723343 CAGGTTGTCTGGAGTGTAGCCGG + Exonic
1053189518 9:36050452-36050474 TAGGGTGGCAGCAGTGGAGATGG - Intronic
1056965787 9:91161917-91161939 CAGGGAGGCTTCTGTGAAGTGGG + Intergenic
1057512686 9:95693749-95693771 CATGGTGGCTTCAGGGTAGCTGG + Intergenic
1057899281 9:98935502-98935524 CAGGGTGGCTGATGTGTGATAGG + Intergenic
1058424509 9:104864738-104864760 CAGGGTGGCAGAAGTGTGGGAGG + Intronic
1059250245 9:112881748-112881770 CAGGGAGCCTTCAGTCTAGTGGG + Intronic
1059711257 9:116869604-116869626 CACGGTTGCTGGAGTGTGGTAGG - Intronic
1060222115 9:121770082-121770104 GAGGGTGCCTGCAGTGTGCTTGG + Intronic
1060382674 9:123191381-123191403 CAAAGTGGCTGCAGTGAGGTGGG + Intronic
1060806286 9:126579303-126579325 CAAGGAGCCTGCAGTCTAGTTGG - Intergenic
1061006644 9:127931813-127931835 CAGAGTGGCTGGAGTGAAGAGGG + Intergenic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1062057034 9:134474126-134474148 CAGGGTGACTGCAGCAGAGTGGG + Intergenic
1062207387 9:135344716-135344738 CAGGGTGGCTGCAGGGCTGTGGG + Intronic
1062287809 9:135780877-135780899 CAGGGATGCTGCCGTGGAGTCGG + Intronic
1062404684 9:136389820-136389842 GAGGGTGGCTGGAGTGAAGCTGG + Intronic
1203524534 Un_GL000213v1:73563-73585 CATGGTGGCTGCCGTGCCGTGGG + Intergenic
1203399470 Un_KI270519v1:72861-72883 GAGAGTGGGTGCAGTATAGTGGG + Intergenic
1187941525 X:24387329-24387351 AAGGGTGACTGCAGTGGAGAGGG + Intergenic
1188491744 X:30745294-30745316 CAGGGTGGCTGCAGGGAGATGGG - Intergenic
1189248559 X:39582040-39582062 CAGGGTGGGGGCAGTGGAGCAGG + Intergenic
1189741425 X:44120872-44120894 CAGGGTGGTTACAGAGGAGTAGG - Intergenic
1189995147 X:46630912-46630934 CATGGTGGCTGCTGGGTAGTTGG - Intronic
1190552572 X:51599843-51599865 TAGAGTGGCTGCAGTCTAGGAGG + Intergenic
1191019304 X:55842531-55842553 CAGGGTGGCTGCACTGTGCTGGG + Intergenic
1192244391 X:69360669-69360691 CAGGGTGGTGGCAGTGGAGATGG + Intergenic
1192551656 X:72059317-72059339 TAGGGTGGCTGCAATGTGGAAGG - Intergenic
1193127934 X:77889410-77889432 CAGGCTGGCTGGAGTGCAGTGGG + Intronic
1193734235 X:85137469-85137491 TAGGGTGGTGGCAGTGTAGGTGG - Intergenic
1193980513 X:88176311-88176333 CAGGGTGGCTGCATGTGAGTGGG - Intergenic
1194539746 X:95156100-95156122 TGGGGTGGCTGCATTGTACTGGG - Intergenic
1195534856 X:105999600-105999622 CAGGGTGGTAGCAGTCTAGGTGG + Intergenic
1196582299 X:117392426-117392448 CAGGGTTGCTGCAGTATGCTGGG - Intergenic
1196582329 X:117392588-117392610 CAGGGTTGCTGCAGTATGCTGGG - Intergenic
1196683613 X:118493313-118493335 CAGTGTGGCTGGAGCGTAGAAGG - Intergenic
1196757779 X:119172848-119172870 CAGGGAGTCTGAAGTGTAGCAGG + Intergenic
1196778534 X:119362148-119362170 CAGGGTGGCTGCTGGGCAGAGGG - Intergenic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1198297107 X:135297875-135297897 CAGGGTGCCAGCATTGTTGTTGG + Intronic
1198394227 X:136206683-136206705 CAAGGTGGCTGCAGTGATGCTGG - Intronic
1198463226 X:136882692-136882714 CAGGGTGGCGGCAGTGGACACGG + Intergenic
1199412695 X:147543107-147543129 TGGGGAGGCGGCAGTGTAGTAGG + Intergenic
1199721501 X:150545964-150545986 CAGGTAGGATGCAGTGTACTTGG - Intergenic
1199824029 X:151479573-151479595 CAGGGTGGTAGCACTGGAGTTGG + Intergenic
1200375212 X:155773140-155773162 TAAGCTGTCTGCAGTGTAGTAGG - Intronic