ID: 944985556

View in Genome Browser
Species Human (GRCh38)
Location 2:205171630-205171652
Sequence AACACAGAGGTGTGTAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 300}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944985556_944985559 2 Left 944985556 2:205171630-205171652 CCTTTTCTACACACCTCTGTGTT 0: 1
1: 0
2: 1
3: 26
4: 300
Right 944985559 2:205171655-205171677 TTGGCAGACGAGCAACTTTGTGG 0: 1
1: 0
2: 0
3: 5
4: 55
944985556_944985560 25 Left 944985556 2:205171630-205171652 CCTTTTCTACACACCTCTGTGTT 0: 1
1: 0
2: 1
3: 26
4: 300
Right 944985560 2:205171678-205171700 TTGTGTTAGACAAAATTATGTGG 0: 1
1: 0
2: 2
3: 19
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944985556 Original CRISPR AACACAGAGGTGTGTAGAAA AGG (reversed) Intronic
902902224 1:19525798-19525820 AACTGAGAGGTGGGTAGAACAGG - Intergenic
902994902 1:20216794-20216816 CACCCAGAGGAGTGCAGAAAGGG - Intergenic
903315196 1:22498248-22498270 AAAACAGAGTTCTGTTGAAAGGG - Intronic
903344869 1:22677474-22677496 AAGATAGGGGTGCGTAGAAAGGG - Intergenic
904894117 1:33801335-33801357 AAGACAGATGTGTGTAGGTAGGG + Intronic
906793379 1:48677930-48677952 AACACAGAGGGATGCAGAATGGG + Intronic
907734916 1:57103209-57103231 AACACAGAGAAGTGTAGGAAGGG + Intronic
908927650 1:69275520-69275542 AGGAGAGAGGTGTGAAGAAAGGG + Intergenic
911121036 1:94296702-94296724 AACACAGAGCTGGGTAGAGAAGG + Intergenic
911246855 1:95527616-95527638 AACACAGCAGTATGTAGACATGG - Intergenic
911248310 1:95545125-95545147 AACAAAAAGTTGTGTAAAAAAGG - Intergenic
911407057 1:97454554-97454576 AAAACAGATGTTTATAGAAAAGG + Intronic
913043396 1:115052220-115052242 AGCACAGAGGGGTGGAGAAGTGG - Intronic
914897618 1:151690939-151690961 AACACAGAGGAGTGAGGAAGAGG - Intronic
914940120 1:152015045-152015067 AACACAGAGATGAGTAAAATAGG + Intergenic
916070689 1:161168016-161168038 AAAACAGAGGTTTGGAGAAGGGG - Exonic
916339252 1:163710663-163710685 AACACAGAACCGTGCAGAAAAGG + Intergenic
916511128 1:165473241-165473263 AACACTGAGCTGTGGAGAGATGG + Intergenic
916739332 1:167634535-167634557 AGGACAGAGGTGTGTAAAGAAGG + Intronic
917475480 1:175365747-175365769 AAAAGAGAGGTGGGTAGAAAAGG - Intronic
918081133 1:181208518-181208540 AAGACAGAGGTGGGCAGAACCGG - Intergenic
918454943 1:184700700-184700722 AACACTGATGTATGTAGTAATGG + Intronic
918892005 1:190286051-190286073 ATCACAGTGGTGTCTTGAAAAGG - Intronic
918978099 1:191517040-191517062 AACTCTGAGGTGTTTAGAGAGGG + Intergenic
919997868 1:202770416-202770438 AAAACAGAGGTGTACAGTAAAGG - Intronic
920133777 1:203753353-203753375 ACCCCAGAGCTGTGCAGAAAGGG - Intergenic
920397844 1:205659674-205659696 AAGGCAGAGGGGTGAAGAAAAGG + Intronic
921437367 1:215139899-215139921 AATACAGAAGTGTATAAAAAAGG + Intronic
921707052 1:218334402-218334424 AAAACAGATGGGTGAAGAAAGGG + Exonic
924158296 1:241204138-241204160 AACACAGGTGTGTATAGAGAAGG + Intronic
924870479 1:248038423-248038445 AATACATAGGTGTGTGGAGATGG - Exonic
1063147030 10:3305076-3305098 TACACTGAAATGTGTAGAAATGG + Intergenic
1063319207 10:5036985-5037007 CACACAAAGGAATGTAGAAAAGG + Intronic
1064195813 10:13243287-13243309 GACACAGATGAGTGTGGAAAGGG + Intergenic
1065357653 10:24858144-24858166 AACACAGAGATATGTGGAACTGG + Intronic
1066586928 10:36945748-36945770 AACATGGAGGTGGGTAGAGATGG - Intergenic
1068265528 10:54643555-54643577 AACAGAAAAGTGTGTACAAAAGG - Intronic
1068653435 10:59549513-59549535 GACATTGAGGGGTGTAGAAAAGG - Intergenic
1069576791 10:69536394-69536416 AATACAGAGGGATGAAGAAATGG + Intergenic
1071250953 10:83819027-83819049 CACACAGAGCTGTGGGGAAAGGG + Intergenic
1073768909 10:106713688-106713710 AAAATAGTGATGTGTAGAAACGG + Intronic
1081342370 11:41943904-41943926 AAAACAGTGGTGGGAAGAAAGGG - Intergenic
1083417340 11:62534219-62534241 AGCACAGGGGAGTGAAGAAAGGG + Intronic
1083519851 11:63299035-63299057 AACATAGAGGTGAGTAGGAAAGG + Exonic
1085901338 11:80703371-80703393 AACATGGAGGTGGGTAGAGATGG + Intergenic
1087140974 11:94765860-94765882 AGGACAGAGGTGTAGAGAAAAGG - Intronic
1087400792 11:97665047-97665069 AACACAGAGCTGATCAGAAATGG + Intergenic
1087740523 11:101882070-101882092 AACAGAGAGGTTTATAGGAATGG - Intergenic
1089822733 11:121242638-121242660 AAAACAAAGATGTATAGAAAAGG + Intergenic
1090621445 11:128564405-128564427 AGCACAGAGGGTTGTAGAGAAGG + Intronic
1091022303 11:132111485-132111507 AACACAGAGGTTTGGACACAAGG + Intronic
1091127174 11:133110844-133110866 AGCACAGAGGTGTGTGGAACAGG + Intronic
1091288797 11:134425172-134425194 CACACAGAGGAGTGAAGAACTGG - Intergenic
1091425601 12:386000-386022 AACACAGTGGTATGTAAACAAGG + Intronic
1091599641 12:1909978-1910000 AACACAGAGGTAGGGAGAATGGG + Intronic
1091693348 12:2611688-2611710 AACACAGATGTGTTCAGAGATGG + Intronic
1093702057 12:22232464-22232486 AATACACAGGTTTGCAGAAAAGG + Intronic
1094019303 12:25897291-25897313 ATCACAGGGGTGTGGAAAAATGG - Intergenic
1094274076 12:28649000-28649022 AACACAAAGATTTATAGAAAAGG - Intergenic
1096165509 12:49420152-49420174 AACACGTAGATGGGTAGAAAAGG + Intronic
1097307634 12:58086986-58087008 AACAAAGATTTGTGTAAAAATGG + Intergenic
1097997211 12:65901059-65901081 AACACAGAGCTGGAAAGAAATGG - Intronic
1098297327 12:69017296-69017318 AACACAGAAATGTGTAAAGAAGG + Intergenic
1098577864 12:72064370-72064392 AACACGGAGGTCTGAAGAGAAGG - Intronic
1101015042 12:100491468-100491490 CACCCAGAGGTGAGAAGAAAAGG - Intronic
1105230660 13:18492315-18492337 AACACAGTGTTATGAAGAAAGGG + Intergenic
1105771256 13:23614178-23614200 AACAAAGAAGTGAGGAGAAAAGG - Intronic
1107035361 13:35896828-35896850 AAGACAGAGGTGTGTGGAGGGGG + Intronic
1108586329 13:51873253-51873275 AACAAAGAGTTGTGCAGGAAAGG + Intergenic
1109814031 13:67555858-67555880 AACACAGAGCTGTGAAGGTAGGG - Intergenic
1110620787 13:77593088-77593110 AACACAGAAGTGAGTTCAAAAGG - Intronic
1113992144 14:16035983-16036005 GACAGAGAGGTGAGTAGACAGGG + Intergenic
1114014906 14:18419128-18419150 AACACAGTGTTATGAAGAAAGGG + Intergenic
1114435285 14:22701416-22701438 AACACACAGTTGTGTGAAAATGG + Intergenic
1114669205 14:24399816-24399838 AACAAAGAGGTGTGTTGCAGAGG - Intronic
1116684864 14:48025952-48025974 AATAAAGAGGTGAGAAGAAAGGG + Intergenic
1117191013 14:53291903-53291925 AACATAGAGATGTGGACAAAGGG + Intergenic
1119080011 14:71684286-71684308 AACACTGAGATATGTAGACAAGG + Intronic
1119368180 14:74113430-74113452 AACACAAAGATGGGTAGAAATGG + Intronic
1119678780 14:76576264-76576286 CACACAGATGTGTGCAGAGATGG - Intergenic
1119962453 14:78874977-78874999 AGCACAGGGGTGTGGAGAATTGG + Intronic
1122218418 14:100219669-100219691 GACAAAGAGGTATGAAGAAAAGG - Intergenic
1122318227 14:100838017-100838039 AACACAGTGATGTGGAGAAGAGG + Intergenic
1125109804 15:36019013-36019035 ATCACAGAGATGCTTAGAAAAGG - Intergenic
1125739192 15:41950074-41950096 CACACAGAGGTCTATGGAAATGG - Intronic
1126376458 15:48001731-48001753 AAGAAGGAGGTGGGTAGAAAGGG + Intergenic
1126829846 15:52590342-52590364 AACACTTAGCTGTTTAGAAACGG - Intronic
1127200201 15:56637717-56637739 AAAACAGAAGTGTGTAAAAATGG + Intronic
1127201009 15:56650797-56650819 AAAACAGAGGAGGGGAGAAATGG + Intronic
1127840111 15:62823950-62823972 CACACAGAGGCCTGCAGAAAAGG - Intronic
1127873857 15:63095856-63095878 AACACAGAGCTGTGTTAAGATGG + Intergenic
1133253826 16:4503814-4503836 AACACAGAAGTGTTAAGAAATGG - Intronic
1134054257 16:11159440-11159462 TCCACAGAAGTGTCTAGAAAGGG + Intronic
1134874528 16:17685385-17685407 AACACAGAATTGGGTAGAGATGG - Intergenic
1136476778 16:30518485-30518507 AATAGAGAGTTGTGTAGAGATGG + Intronic
1140767790 16:78176063-78176085 AATTAAGAGGTGTGCAGAAATGG - Intronic
1141742463 16:85902912-85902934 AACTCAGAGGTTTGCAGCAAAGG - Intronic
1143838997 17:9716562-9716584 AACACAGGGGTTTGAAGAAGAGG + Intronic
1144794206 17:17880164-17880186 AACTCAGAGCTTTGTAGAATAGG - Intronic
1148386540 17:47238473-47238495 CACAGAGAGGTGTGCAGAGAGGG - Intergenic
1150656444 17:67042771-67042793 AACACAGAGGTGGGGGGACAGGG + Intergenic
1151350122 17:73526958-73526980 AACACAAAGAGGTGTAGACATGG + Intronic
1153073292 18:1131722-1131744 AACTCAGAACTGTGTAGGAAAGG + Intergenic
1154522746 18:15247552-15247574 AACACAGTGTTATGAAGAAAGGG - Intergenic
1156111574 18:33733414-33733436 ACCAGATAGGTGTGGAGAAAAGG - Intronic
1157530216 18:48413985-48414007 AAAAAAGAGGTGTATAGAAGAGG - Intergenic
1158814987 18:61084954-61084976 AACACAGAAATGTCAAGAAATGG - Intergenic
1159279093 18:66260850-66260872 AACATACAGCTGTGTATAAATGG - Intergenic
1159837980 18:73363692-73363714 TATACAGAGGAGTTTAGAAAGGG - Intergenic
1161884393 19:6982638-6982660 AACACTGAAGGTTGTAGAAAAGG + Intergenic
1163409242 19:17143313-17143335 AATACAGAGGTGTATAGCCAAGG - Intronic
1164590646 19:29505091-29505113 AAAGCAGAGGTCTGAAGAAATGG + Intergenic
1165230821 19:34385536-34385558 TAAACACAGGTGTGTAGAACAGG + Intronic
1166415403 19:42591717-42591739 GACACAGATGTGTGTGGAACAGG + Intronic
1167296058 19:48650542-48650564 GACACAGAGTTGTGGAGAGATGG + Intergenic
924985931 2:269874-269896 AATGCACAGCTGTGTAGAAATGG - Intronic
925967084 2:9076027-9076049 TACAGACAGGCGTGTAGAAAGGG - Intergenic
926148904 2:10413688-10413710 ATCACAGATGCGTATAGAAAGGG - Intronic
926624780 2:15082073-15082095 AACAAAAATGTGTGTAAAAATGG + Intergenic
927808032 2:26165418-26165440 GACACAGAGCTGGGAAGAAATGG + Intergenic
928266658 2:29817697-29817719 AACACAGTGGTATGTATAAAGGG - Intronic
928916903 2:36481858-36481880 AAGCCAGAGGTGAGTAGAGATGG - Intronic
931456373 2:62412568-62412590 ACCCCAGAGGTGTGTAGAAGAGG - Intergenic
931761395 2:65420294-65420316 AACACGGAGGTGGGTACAATGGG - Intronic
931839772 2:66136080-66136102 AACAAAGAGGTGTTGAGATAGGG + Intergenic
932417537 2:71582771-71582793 AACACAGAGCTGGGAAGAGACGG + Intronic
932875965 2:75452385-75452407 AACATAGATGTGTGTACATATGG - Intergenic
933283997 2:80364773-80364795 GACACAGAGGTGATTATAAAAGG - Intronic
935979551 2:108613498-108613520 GACACAGAGATGTGTAGGGAGGG - Intronic
936686548 2:114834054-114834076 TATACATAGGTGTGTAGATATGG - Intronic
936686556 2:114834170-114834192 TATACATAGGTGTGTAGATATGG - Intronic
936686558 2:114834199-114834221 TATACATAGGTGTGTAGATATGG - Intronic
936686561 2:114834230-114834252 TATACATAGGTGTGTAGATATGG - Intronic
936686564 2:114834288-114834310 TATACATAGGTGTGTAGACATGG - Intronic
936686566 2:114834317-114834339 TATACATAGGTGTGTAGACATGG - Intronic
936686570 2:114834404-114834426 TATACATAGGTGTGTAGATATGG - Intronic
936686574 2:114834462-114834484 TATACATAGGTGTGTAGATATGG - Intronic
936686585 2:114834636-114834658 TATACATAGGTGTGTAGATATGG - Intronic
936686588 2:114834667-114834689 TATACATAGGTGTGTAGATATGG - Intronic
936686595 2:114834783-114834805 TATACATAGGTGTGTAGACATGG - Intronic
936686597 2:114834812-114834834 TATACATAGGTGTGTAGACATGG - Intronic
936686599 2:114834841-114834863 TATACATAGGTGTGTAGACATGG - Intronic
936686601 2:114834899-114834921 TATACATAGGTGTGTAGATATGG - Intronic
936686603 2:114834928-114834950 TATACATAGGTGTGTAGATATGG - Intronic
936686605 2:114834957-114834979 TATACATAGGTGTGTAGATATGG - Intronic
936686609 2:114835044-114835066 TATACATAGGTGTGTAGATATGG - Intronic
936686611 2:114835073-114835095 TATACATAGGTGTGTAGATATGG - Intronic
936686613 2:114835102-114835124 TATACATAGGTGTGTAGATATGG - Intronic
936686616 2:114835160-114835182 TATACATAGGTGTGTAGATATGG - Intronic
936686625 2:114835278-114835300 TATACATAGGTGTGTAGATATGG - Intronic
936686628 2:114835336-114835358 TATACATAGGTGTGTAGATATGG - Intronic
938522031 2:132080405-132080427 AACACAGTGTTATGAAGAAAGGG - Intergenic
938884743 2:135633083-135633105 AAAATAGATGTGTTTAGAAAGGG + Intronic
939462211 2:142511762-142511784 AAAACTGAGGTGTATAGACAAGG + Intergenic
940563859 2:155335852-155335874 ACCAGATAGGTGTGTAGGAATGG + Intergenic
940829610 2:158453493-158453515 AAAACAGAGGTGGGTGGCAAAGG - Intronic
942404327 2:175637361-175637383 AAAACTGTGGTGTGTAGAAAAGG + Intergenic
942714742 2:178879440-178879462 AACATAGAGGCATGTATAAATGG - Intronic
943536486 2:189157929-189157951 AAAACACAGATGTGTAGAATGGG - Intronic
944985556 2:205171630-205171652 AACACAGAGGTGTGTAGAAAAGG - Intronic
944993310 2:205263133-205263155 AACACAGATGAGCTTAGAAAAGG - Intronic
945426228 2:209707177-209707199 AACACAGTGGTTTGAAGAAGTGG - Intronic
945697512 2:213126283-213126305 AACATAAGGGTGTGAAGAAATGG - Intronic
946572946 2:221044276-221044298 AACAGAGAGGTGTTTAGAGATGG - Intergenic
948066481 2:235084654-235084676 AACTCAGCCGTGTGTAGAGAAGG - Intergenic
1170462139 20:16587462-16587484 AGGACACAGGTGTGTAAAAAGGG + Intergenic
1171346978 20:24472769-24472791 AGCACAGAGGTGTGCAGAATGGG - Intronic
1172208494 20:33181402-33181424 CACACAGAAGGGTGCAGAAATGG - Exonic
1172624856 20:36341115-36341137 AACAGAGAGCTGTGCAGACAGGG - Intronic
1173873927 20:46358006-46358028 AGCTCACAGGTGTGTTGAAATGG - Intronic
1174660478 20:52208321-52208343 AACAAAAAGTTGTGCAGAAAAGG - Intergenic
1174923512 20:54731217-54731239 AATACAGAGGTGTATAAAACAGG + Intergenic
1175156377 20:56974446-56974468 ACCACAGTAGTGTGTTGAAATGG - Intergenic
1176774650 21:13120662-13120684 AACACAGTGTTATGAAGAAAGGG + Intergenic
1177703498 21:24669822-24669844 AACACAGAGGTGTGTTGGGGGGG + Intergenic
1177893671 21:26836669-26836691 AAAAATGAGGTGTGTAGAACAGG - Exonic
1179825404 21:43962614-43962636 AAAACCGGGGTGTGCAGAAATGG + Intronic
1179936458 21:44608339-44608361 AACACAGAGATGGGAAGAGAGGG - Intronic
1180315127 22:11271544-11271566 GACAGAGAGGTGAGTAGACAGGG - Intergenic
1180439404 22:15349901-15349923 AACACAGTGTTATGAAGAAAGGG + Intergenic
1180522270 22:16220383-16220405 AACACAGTGTTATGAAGAAAGGG + Intergenic
1182844221 22:33417345-33417367 AACACACTGGTGATTAGAAATGG - Intronic
1183184557 22:36284633-36284655 TACACATAGGTGTCTAGCAAAGG - Intronic
949433317 3:4002063-4002085 AACAGAGAGTGGTGTAGTAAAGG + Intronic
950105623 3:10386499-10386521 ATCACACAGGTGTGAAGAAGGGG - Exonic
950707867 3:14794070-14794092 CACTCAGAGCTGTGCAGAAATGG - Intergenic
951495603 3:23321621-23321643 AACACAGAGTTGTGGGGGAATGG + Intronic
952036855 3:29212988-29213010 AACCCAGGGGTGTGTAAAGAAGG - Intergenic
952276679 3:31883836-31883858 TACACAAAGGTAAGTAGAAAAGG + Intronic
952583122 3:34858303-34858325 AACACAGAACTGTGTAGAAGAGG - Intergenic
952850601 3:37725419-37725441 TACACACAGGTGTGGGGAAAAGG - Intronic
956873153 3:73437815-73437837 AACACACAATTGTGTAAAAAAGG + Intronic
956912143 3:73829083-73829105 CACACAGAGGTATGTAGAGGTGG + Intergenic
957452783 3:80401456-80401478 AATACAGAGGAGGGTAAAAAAGG - Intergenic
958446868 3:94226326-94226348 CATACAGAGGTGGGTAGACAGGG + Intergenic
958576866 3:95961435-95961457 AATAGAGAGGAGTGCAGAAAAGG + Intergenic
959765250 3:110019014-110019036 ACCACAGATGTATCTAGAAATGG - Intergenic
959767961 3:110055921-110055943 ATAACAAAGGTGTGGAGAAAAGG + Intergenic
960418664 3:117416026-117416048 AGCACAGTGATATGTAGAAATGG - Intergenic
960717636 3:120593481-120593503 AAAACAGAGATGAGTACAAAAGG - Intergenic
960970072 3:123133029-123133051 AATGAAGAAGTGTGTAGAAAGGG - Intronic
962462556 3:135627994-135628016 AAGACAGAGTTGTTTAGAATGGG + Intergenic
962466983 3:135669686-135669708 AACACAGAACTATGTAGAATGGG + Intergenic
962724159 3:138205591-138205613 AACAGACACGTGTGGAGAAAGGG - Intronic
963156292 3:142100682-142100704 CAGAGAGAGGTGTGAAGAAAGGG - Intronic
963668991 3:148228414-148228436 AAAAATGAGGTGTGTAAAAATGG + Intergenic
964698224 3:159534154-159534176 AATCCAGAGATGTCTAGAAAAGG - Intronic
965602250 3:170467028-170467050 AACACACAAGTGGGTAGAAATGG - Exonic
966447908 3:180024145-180024167 AACACAGAGGTCTTTCTAAAAGG - Intronic
969069335 4:4521606-4521628 AATACAGATGATTGTAGAAAGGG + Intronic
971372961 4:26032933-26032955 AGCACAGGGTTGGGTAGAAAGGG + Intergenic
972087978 4:35243123-35243145 AACACTTAGGTGAGTTGAAAAGG + Intergenic
972171403 4:36350053-36350075 AAAGCAGAGCTGTGTATAAAGGG - Intergenic
972708641 4:41571372-41571394 AACACAGGAGTGTATAAAAAAGG + Intronic
974028643 4:56756301-56756323 AAGACAGAGGAGGGTAGGAACGG - Intergenic
975679114 4:76858068-76858090 AAGACAGAGGTGGATGGAAAGGG + Intergenic
975902191 4:79166254-79166276 AGAACATAGGTGTATAGAAAGGG - Intergenic
975943219 4:79673344-79673366 AACACAGTGGGGTGTTAAAAAGG + Intergenic
976076022 4:81299752-81299774 AACACTGAGATGTGCAGGAAAGG + Intergenic
976748413 4:88429365-88429387 ATCACAGAGGGGTGAAGAATTGG + Intronic
976885125 4:89972981-89973003 TACATAAAGGTGTGTGGAAATGG + Intergenic
977586871 4:98783821-98783843 AGCAGAGAGGAGGGTAGAAAGGG + Intergenic
977796934 4:101177218-101177240 GACACAGAGGTGTTTTTAAAGGG + Intronic
980528655 4:134021609-134021631 GACACAGAGGTGTCTAGTTAAGG + Intergenic
980809774 4:137861087-137861109 AACCCAAAGATGTGAAGAAATGG + Intergenic
980879729 4:138697592-138697614 AACAGAGAGGGAAGTAGAAAAGG - Intergenic
983825759 4:172257599-172257621 AAAGCAGAGGTGTTTAGTAATGG + Intronic
984058150 4:174954660-174954682 AACAGAGATGTGTGTAAAAAAGG - Intronic
984444164 4:179812786-179812808 AACTCAGAGGAGAGTAGATAAGG + Intergenic
985802250 5:2012368-2012390 AAGACAGACGTGTGGAGGAAAGG - Intergenic
985927314 5:3028305-3028327 AGCAGAGAGGTGTGTGGAGAGGG + Intergenic
986428116 5:7654718-7654740 AACACAGAGGGGTGGAAAACGGG + Intronic
986442825 5:7796779-7796801 CACACAGAGGTGGGGAGAACAGG - Intronic
987507774 5:18795332-18795354 ATCACAAAGGTTTTTAGAAATGG - Intergenic
988026394 5:25696643-25696665 AATACAGACATGTGCAGAAAAGG + Intergenic
988450859 5:31341729-31341751 AACACAGAGTTGTCTGGGAAAGG - Intergenic
989023570 5:37040421-37040443 GACACAGAGGTATATATAAATGG + Intronic
989495280 5:42104708-42104730 AACACAGAGAAGTGTTCAAAGGG - Intergenic
990235383 5:53761798-53761820 AGCACAGAGATGGGTAGAAAGGG + Intergenic
991228038 5:64295603-64295625 AGCACAGGGGTGGGTAAAAAAGG - Intronic
991947034 5:71908160-71908182 AACACAGAGGTGTGAATACCAGG + Intergenic
992517360 5:77508413-77508435 AACACAGACGTTTTTATAAAAGG - Intronic
995259407 5:110084185-110084207 AAAACAGAGTTGTGTAAAAGAGG - Intergenic
995524450 5:113039396-113039418 CACACAGAGCTGTGAAGCAATGG - Intronic
996872915 5:128212078-128212100 GACGCTGAGGTGTGTAGGAACGG - Intergenic
997050022 5:130369115-130369137 AACTCAGAGCTGTGAAGACATGG - Intergenic
997443284 5:133923860-133923882 AAAACAGAGGTGACTGGAAAAGG - Intergenic
998248982 5:140536616-140536638 AACAAAAAGGGCTGTAGAAAGGG + Intronic
998323578 5:141257067-141257089 AACAAAAAGGAGTCTAGAAAAGG - Intergenic
999279431 5:150355362-150355384 TTCACAGAGGTGTGTTGGAATGG - Intergenic
1000388508 5:160699051-160699073 AACACATAGGTGAGCATAAAAGG - Intronic
1001426258 5:171624653-171624675 AAAACACAGGTGTGTGGAACTGG + Intergenic
1005978497 6:30818059-30818081 TACAAGGAGGTGGGTAGAAAAGG - Intergenic
1006405012 6:33839947-33839969 AGCACAGAGGTCTGCAGAGAGGG + Intergenic
1006970506 6:38039413-38039435 AACACAAATGTGTATAGAAAAGG - Intronic
1006977167 6:38113952-38113974 GACACAGAGGTGTGAAAGAAAGG + Intronic
1007028675 6:38605640-38605662 AACAAAAAGTTGTGTAGATAAGG - Intronic
1008803927 6:55404938-55404960 AGGAAAGATGTGTGTAGAAAAGG - Intergenic
1010165480 6:72910358-72910380 AACACAGTGAGGGGTAGAAAAGG + Intronic
1011489244 6:87873953-87873975 AATAGACAGCTGTGTAGAAATGG + Intergenic
1011566211 6:88675354-88675376 AATACAGAGTTGAGTAGAAATGG - Intronic
1011695884 6:89912342-89912364 AACACAGTGATGTGGACAAAGGG + Intergenic
1012655805 6:101818526-101818548 AACACAGAAGTGCATAGAAAAGG + Intronic
1012739205 6:102992948-102992970 GAGCCAGAGGTGAGTAGAAAAGG + Intergenic
1013185039 6:107750073-107750095 CACACAGAGGTGTGAAGAGTTGG + Intronic
1013222502 6:108091462-108091484 AAGAGAGAAGTTTGTAGAAAAGG + Intronic
1013854693 6:114558088-114558110 TACACAGAGTTGTCTAGAAGAGG + Intergenic
1016511852 6:144851241-144851263 AACAGAGAGGTATTTGGAAATGG + Exonic
1017681126 6:156864899-156864921 AACAAAGAGCTGTGTAGAAAAGG - Intronic
1018197456 6:161367673-161367695 AACACAGAGCTGTGTAGGCATGG + Intronic
1018246213 6:161826772-161826794 AACAGAGAGGCATGTAGGAACGG + Intronic
1022963174 7:35449596-35449618 AACAGAGATGTGTGTAAGAAAGG + Intergenic
1024421758 7:49175573-49175595 AACACATAGGAGTGGGGAAAAGG - Intergenic
1026684390 7:72495670-72495692 AACAGAGAAGTGTGGACAAACGG + Intergenic
1027179752 7:75930226-75930248 AACACAGTGCTGTGTAGACTAGG + Intronic
1027412213 7:77932747-77932769 ATCACATAGCTGTGTAGAATAGG - Intronic
1027591691 7:80126659-80126681 AACACAGAACTGTTTAGAAAGGG + Intergenic
1030781432 7:113605404-113605426 AACACAGAGCAGGGGAGAAAGGG + Intergenic
1031583125 7:123501752-123501774 AAAACAAGGGTGTGTATAAATGG - Intronic
1031965900 7:128028235-128028257 AAGAAAGATGTCTGTAGAAATGG + Exonic
1032109430 7:129062923-129062945 AACACATTGGTGTGCTGAAATGG + Intergenic
1032407849 7:131670087-131670109 CACACAGAAGGGTGGAGAAATGG + Intergenic
1036000702 8:4600305-4600327 AATATAGAGATGGGTAGAAATGG + Intronic
1039855988 8:41414701-41414723 AACAAAGAGGTATGTAGGGAAGG + Intergenic
1041053780 8:53961837-53961859 AGAACACAGATGTGTAGAAAAGG + Intergenic
1041058521 8:54013229-54013251 ACCAGAGAGCTGAGTAGAAAAGG - Intronic
1041288980 8:56290465-56290487 AACACAGGAGTGAGAAGAAAAGG - Intergenic
1042452527 8:68965376-68965398 AACAAGGAGGTGAGTAGAAGCGG - Intergenic
1042569909 8:70152407-70152429 AACACAAAGTTGTTAAGAAATGG + Intronic
1045046091 8:98280147-98280169 AATACAGGGGTGTGTGGAATTGG + Intronic
1045818774 8:106309897-106309919 AATAGAGAGGTGGGAAGAAAGGG - Intronic
1048441456 8:134462493-134462515 AACACAAAGGTGTTGAGTAAAGG + Intergenic
1048536916 8:135305158-135305180 TACTCAGAGATGTTTAGAAATGG + Intergenic
1048936997 8:139365680-139365702 TAGACACAGGTGTGTACAAAGGG + Intergenic
1051077853 9:13261390-13261412 AACAAATAGGTGTGTTTAAATGG - Intronic
1052109012 9:24556815-24556837 AACAGAGAGAAGTGCAGAAATGG - Intergenic
1056444817 9:86655694-86655716 CACCCAGAGCTGTGTAGACATGG - Intergenic
1057224540 9:93284064-93284086 CACACAGAGGTGTGTATAAGGGG + Intronic
1058609567 9:106760729-106760751 AACACTAAGGTTTGTAGAACAGG + Intergenic
1060149099 9:121276209-121276231 AACACACAGATGTGTGCAAATGG - Intronic
1060173403 9:121479722-121479744 ACCACAGAGGAGTGGACAAAGGG + Intergenic
1062681782 9:137785976-137785998 AAAACAAGGGAGTGTAGAAAAGG + Intronic
1187085872 X:16043187-16043209 AACAAAGAAGGGTATAGAAAAGG - Intergenic
1187989964 X:24859575-24859597 GCCACAGAGGTGTGTACAAAAGG - Intronic
1188076586 X:25784348-25784370 ATCACAGATATTTGTAGAAAAGG - Intergenic
1188383030 X:29520955-29520977 AACACAAAGCTGTGTTCAAAGGG - Intronic
1189523939 X:41800067-41800089 AACACAGAGCTGTGTGGGCAGGG - Intronic
1192733689 X:73827389-73827411 TACTCAAAGGTGAGTAGAAAGGG + Intergenic
1194807827 X:98351208-98351230 AAGACTGAGGTGGGTGGAAAAGG + Intergenic
1194986112 X:100491377-100491399 AACACACAGTAGTGTAGAAAAGG + Intergenic
1195769599 X:108336349-108336371 AACACAGATGAATGTCGAAAAGG + Intronic
1196493415 X:116294917-116294939 ATTACAGAGATGTGAAGAAAAGG + Intergenic
1197738521 X:129871253-129871275 AAAATAGAGATGTGGAGAAATGG - Intergenic
1197868395 X:131042592-131042614 ATAACAGAGGTGTGGACAAAGGG - Intergenic
1198083478 X:133261618-133261640 ATCACAGAGGTGTTTATAAGAGG + Intergenic
1199158275 X:144575773-144575795 AACACAGAGCAGAATAGAAAAGG + Intergenic
1199599451 X:149533301-149533323 AACAGGGAGGTGTGGAGCAAGGG - Exonic
1199651180 X:149946906-149946928 AACAGGGAGGTGTGGAGCAAGGG + Intergenic
1199727806 X:150602084-150602106 AACACAGAGGCATGAAGAAAAGG - Intronic
1199852031 X:151731312-151731334 AGCACAGTAGTGTTTAGAAATGG + Intergenic
1201074892 Y:10179385-10179407 AACAGAGAGGTGACTAGACAGGG + Intergenic
1201280957 Y:12341406-12341428 AAAACAGAAGTGTGGAGACATGG - Intergenic
1201788482 Y:17810619-17810641 TCCACAGAGGTGCGAAGAAATGG + Intergenic
1201813071 Y:18095369-18095391 TCCACAGAGGTGCGAAGAAATGG - Intergenic
1201859268 Y:18577225-18577247 AAGACAAAAATGTGTAGAAAGGG + Intronic
1201874054 Y:18743156-18743178 AAGACAAAAATGTGTAGAAAGGG - Intronic
1202361089 Y:24111036-24111058 AAAACAGAGATGTGGACAAATGG - Intergenic
1202509689 Y:25559082-25559104 AAAACAGAGATGTGGACAAATGG + Intergenic