ID: 944987707

View in Genome Browser
Species Human (GRCh38)
Location 2:205196957-205196979
Sequence GCTGATTGTACAGTCCATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 72}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944987707_944987711 25 Left 944987707 2:205196957-205196979 CCTGCATGGACTGTACAATCAGC 0: 1
1: 0
2: 0
3: 2
4: 72
Right 944987711 2:205197005-205197027 ACAGGAATGCTTCCACTGTGGGG 0: 1
1: 0
2: 3
3: 17
4: 220
944987707_944987712 26 Left 944987707 2:205196957-205196979 CCTGCATGGACTGTACAATCAGC 0: 1
1: 0
2: 0
3: 2
4: 72
Right 944987712 2:205197006-205197028 CAGGAATGCTTCCACTGTGGGGG 0: 1
1: 0
2: 1
3: 17
4: 208
944987707_944987708 7 Left 944987707 2:205196957-205196979 CCTGCATGGACTGTACAATCAGC 0: 1
1: 0
2: 0
3: 2
4: 72
Right 944987708 2:205196987-205197009 AATGAGTTTAAAGATGAAACAGG 0: 1
1: 0
2: 2
3: 25
4: 419
944987707_944987716 30 Left 944987707 2:205196957-205196979 CCTGCATGGACTGTACAATCAGC 0: 1
1: 0
2: 0
3: 2
4: 72
Right 944987716 2:205197010-205197032 AATGCTTCCACTGTGGGGGGGGG 0: 1
1: 0
2: 1
3: 16
4: 262
944987707_944987709 23 Left 944987707 2:205196957-205196979 CCTGCATGGACTGTACAATCAGC 0: 1
1: 0
2: 0
3: 2
4: 72
Right 944987709 2:205197003-205197025 AAACAGGAATGCTTCCACTGTGG 0: 1
1: 0
2: 1
3: 16
4: 192
944987707_944987715 29 Left 944987707 2:205196957-205196979 CCTGCATGGACTGTACAATCAGC 0: 1
1: 0
2: 0
3: 2
4: 72
Right 944987715 2:205197009-205197031 GAATGCTTCCACTGTGGGGGGGG 0: 1
1: 0
2: 0
3: 12
4: 241
944987707_944987714 28 Left 944987707 2:205196957-205196979 CCTGCATGGACTGTACAATCAGC 0: 1
1: 0
2: 0
3: 2
4: 72
Right 944987714 2:205197008-205197030 GGAATGCTTCCACTGTGGGGGGG 0: 1
1: 0
2: 2
3: 23
4: 192
944987707_944987710 24 Left 944987707 2:205196957-205196979 CCTGCATGGACTGTACAATCAGC 0: 1
1: 0
2: 0
3: 2
4: 72
Right 944987710 2:205197004-205197026 AACAGGAATGCTTCCACTGTGGG 0: 1
1: 0
2: 6
3: 25
4: 272
944987707_944987713 27 Left 944987707 2:205196957-205196979 CCTGCATGGACTGTACAATCAGC 0: 1
1: 0
2: 0
3: 2
4: 72
Right 944987713 2:205197007-205197029 AGGAATGCTTCCACTGTGGGGGG 0: 1
1: 0
2: 2
3: 28
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944987707 Original CRISPR GCTGATTGTACAGTCCATGC AGG (reversed) Intronic
902188403 1:14742862-14742884 GGTGCTTGTACAATCCAGGCAGG - Intronic
904384649 1:30133322-30133344 GCTGCCTGTACTGGCCATGCTGG - Intergenic
906124335 1:43417884-43417906 GCTGATTCTTCATTCCTTGCTGG - Intronic
906841954 1:49148592-49148614 GCTGGCTGTGCAGTCCAAGCAGG + Intronic
907704333 1:56819686-56819708 CCTGTTAGTACAGACCATGCAGG + Intronic
911567947 1:99486378-99486400 TCTAATTGTATAATCCATGCAGG + Intergenic
911911365 1:103641078-103641100 GATCATTGTAAAGTCCAGGCAGG - Intergenic
911917089 1:103710872-103710894 GATCATTGTAAAGTCCAGGCAGG + Intronic
911918780 1:103735216-103735238 GATCATTGTAAAGTCCAGGCAGG - Intronic
914684595 1:149967312-149967334 CCTCATTGAGCAGTCCATGCTGG - Exonic
919418274 1:197338921-197338943 GCTGATTGTAAAGTGCATCTCGG + Intronic
922595365 1:226809014-226809036 GCTGCTTGCACAGCACATGCTGG - Intergenic
1073752489 10:106544538-106544560 GCTAATTGTACAGGGCATGGAGG + Intergenic
1075392564 10:122103016-122103038 GCTGCTTGTACAGCCCATCATGG + Intronic
1076668117 10:132104420-132104442 GCTGAGTGTTCATCCCATGCTGG + Intergenic
1077089741 11:773023-773045 GCTGCCTGTCCAGGCCATGCTGG + Intronic
1083262129 11:61528869-61528891 GATGACTGTACCGTCCATGGGGG + Intronic
1087831034 11:102820113-102820135 GCTCATGGTACAGTCCCTGACGG + Intergenic
1088142347 11:106632801-106632823 GCTGATTTTGCATTACATGCAGG - Intergenic
1089774005 11:120823606-120823628 GCTGTTTGTGCAGACCATGATGG - Intronic
1091150140 11:133320819-133320841 GCTGGATGTAAAGTCCATGAAGG + Intronic
1104480453 12:129103358-129103380 GCTGATGGTATTGTCCATGAGGG - Intronic
1107114974 13:36737044-36737066 GCTAATTATATAGTCCAGGCAGG - Intergenic
1115148001 14:30248869-30248891 CCTGTTGGTAGAGTCCATGCTGG - Intergenic
1117363911 14:55005765-55005787 GCTGATTCTAAAGCCCATGAGGG - Intronic
1125250899 15:37702408-37702430 ACTGATTGTAAATTCAATGCTGG - Intergenic
1126115713 15:45205692-45205714 GCATATTGAACAGTCTATGCTGG - Intergenic
1131740184 15:95381331-95381353 GCTGACTTTACAGATCATGCTGG + Intergenic
1133059424 16:3164753-3164775 GCTGGGTGCACAGTCCCTGCCGG - Intergenic
1136702924 16:32159865-32159887 GTTGTTTGTACAGTCAATTCAGG - Intergenic
1136764776 16:32767731-32767753 GTTGTTTGTACAGTCAATTCAGG + Intergenic
1136803323 16:33102653-33102675 GTTGTTTGTACAGTCAATTCAGG - Intergenic
1140302786 16:73774381-73774403 GCTGCCTTCACAGTCCATGCTGG + Intergenic
1203067132 16_KI270728v1_random:1029856-1029878 GTTGTTTGTACAGTCAATTCAGG + Intergenic
1148066544 17:44875067-44875089 GCTGATTCTAGAGCCCAGGCTGG + Intronic
1148075463 17:44932948-44932970 GCTGATGTGACAGTCCAGGCTGG + Exonic
1151604806 17:75129609-75129631 GCTGGGTGGACAGTCAATGCTGG - Exonic
1165145346 19:33726817-33726839 GCTGAGGGGACAGTGCATGCCGG + Intronic
936516942 2:113186990-113187012 CCTAATGGTGCAGTCCATGCAGG + Intronic
938201864 2:129378655-129378677 CCTGATAATACAGGCCATGCCGG - Intergenic
940544251 2:155062909-155062931 GCAGATTGTGCACTCCATGATGG + Intergenic
940687748 2:156875075-156875097 TCTTTTTGTCCAGTCCATGCTGG + Intergenic
944360149 2:198844589-198844611 GGTGATTGTACCATCCATCCAGG - Intergenic
944987707 2:205196957-205196979 GCTGATTGTACAGTCCATGCAGG - Intronic
1175020153 20:55837807-55837829 GAAGAATGTACATTCCATGCTGG + Intergenic
1178050199 21:28738545-28738567 GCAGATTGAACTGTCCCTGCCGG - Intergenic
1179636808 21:42717340-42717362 ACTGATTGTACACTCCAACCTGG - Intronic
1180011647 21:45055172-45055194 GCTGAGGGTGCAGTCCACGCAGG + Intergenic
1180136550 21:45865966-45865988 ACAGATGGTCCAGTCCATGCGGG - Intronic
1182505605 22:30780114-30780136 GCTGAGTGTTCAGTCCTTGAGGG + Intronic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
956378330 3:68639406-68639428 GTTGATTGGTCAGTCCATACTGG + Intergenic
961312834 3:126014724-126014746 GCTGTTTCTTCAGTCCCTGCAGG + Intronic
972151094 4:36092200-36092222 GCTACTTGAACAGTCCAGGCAGG - Intronic
972332723 4:38078824-38078846 TCTGGTTGCAAAGTCCATGCAGG - Intronic
973810393 4:54563911-54563933 GCTTATTGGCCAGGCCATGCTGG + Intergenic
974480225 4:62433127-62433149 GCTGACCTTACACTCCATGCAGG - Intergenic
983180638 4:164644233-164644255 ACTGAATGTACAGTCCAGGAGGG - Intergenic
983739622 4:171113005-171113027 GCTGATTGAACAGTCTCTGGTGG + Intergenic
984614061 4:181875668-181875690 TCTGAACGTAGAGTCCATGCAGG - Intergenic
992953440 5:81883610-81883632 GCTGGTTGTCCAGCCCTTGCGGG + Intergenic
996838005 5:127815487-127815509 GCTGAAGGTAGATTCCATGCAGG - Intergenic
1002979075 6:2116714-2116736 GCTGACTGTATCGTCCTTGCTGG + Intronic
1019796574 7:3054322-3054344 GCTGATTGTGCTGGCCTTGCTGG + Intergenic
1019826631 7:3289873-3289895 GCAGATTGTACTTTCCATGATGG + Intergenic
1022204442 7:28149892-28149914 GCTGATTGGAAAGTCCCTTCTGG + Intronic
1031866216 7:127040372-127040394 TCTGAGTGTAAAGTCCTTGCTGG - Intronic
1032287711 7:130554680-130554702 GCTGATTATACAGTCCACAATGG + Exonic
1032890432 7:136189439-136189461 TCTGATTCTACAGTACATGCAGG + Intergenic
1039584736 8:38696861-38696883 TCTGATTGCAAAGTCCATGCAGG + Intergenic
1039867009 8:41513750-41513772 GGAGATTGTACATTCCATGAGGG + Intergenic
1046945650 8:119971915-119971937 ACTGTTTGTACAGTCTAGGCAGG + Intronic
1050206240 9:3199417-3199439 TCTGAATGCACAGTCCTTGCTGG - Intergenic
1058605633 9:106719760-106719782 GCTGATTGTACAGTTCCATCTGG + Intergenic
1060718382 9:125955843-125955865 CCAGATTGTAAAGTCCAGGCAGG + Intronic