ID: 944991307

View in Genome Browser
Species Human (GRCh38)
Location 2:205239247-205239269
Sequence AAGGTGTTCTAGGTGCTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944991301_944991307 -7 Left 944991301 2:205239231-205239253 CCCTTCCCCAGGAGTAAAGGTGT 0: 1
1: 0
2: 2
3: 21
4: 177
Right 944991307 2:205239247-205239269 AAGGTGTTCTAGGTGCTAAAAGG 0: 1
1: 0
2: 1
3: 12
4: 146
944991302_944991307 -8 Left 944991302 2:205239232-205239254 CCTTCCCCAGGAGTAAAGGTGTT 0: 1
1: 0
2: 1
3: 12
4: 128
Right 944991307 2:205239247-205239269 AAGGTGTTCTAGGTGCTAAAAGG 0: 1
1: 0
2: 1
3: 12
4: 146
944991298_944991307 14 Left 944991298 2:205239210-205239232 CCTTTTTATTTTCATGCTACTCC 0: 1
1: 0
2: 1
3: 26
4: 413
Right 944991307 2:205239247-205239269 AAGGTGTTCTAGGTGCTAAAAGG 0: 1
1: 0
2: 1
3: 12
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944991307 Original CRISPR AAGGTGTTCTAGGTGCTAAA AGG Intronic
900391378 1:2435434-2435456 AAGCTGTTTTAGGTTCCAAATGG + Intronic
900869931 1:5294944-5294966 AATGTGTTCTTGGTACAAAAAGG - Intergenic
902637836 1:17746672-17746694 AATGTGTTCTAGGCTCTACATGG - Intergenic
903249017 1:22038794-22038816 AAGGTGTTGTAGGAGCTCACAGG - Intergenic
903792107 1:25900846-25900868 ATGTTGTTTTAGGGGCTAAAGGG - Intronic
904111400 1:28129171-28129193 AAGGTGTGCTATGGGCTTAAGGG - Intergenic
904872319 1:33626434-33626456 AAGGTGATCTCGGTTCTTAAGGG - Intronic
905093896 1:35452318-35452340 AGGGTGTCCTAGGTGCTTGATGG - Intronic
906566196 1:46802914-46802936 AAGGTGCTCTCTGTGCAAAAAGG + Intronic
907913249 1:58845546-58845568 AAGGTTTTTTATGTGCAAAATGG + Intergenic
908051737 1:60240144-60240166 AAAGTGTTGAAGGTGCTGAATGG - Intergenic
908902793 1:68975495-68975517 AAGGTATTCTAAGTGGTAAGGGG - Intergenic
909625530 1:77711613-77711635 CAAGTGTTCTAGGTGCATAATGG - Intronic
911418734 1:97611504-97611526 AAGGTGTTCTAGGAGGTTACAGG + Intronic
911975015 1:104481191-104481213 AAGGTGTTATAGATGCAAAATGG - Intergenic
912037441 1:105336512-105336534 AAGATATTCTAGGTGTTAAGAGG - Intergenic
912581595 1:110725864-110725886 ATGTTGTTCTAGGTGCTGCAAGG - Intergenic
915126019 1:153665496-153665518 CAGGTGTTCAAGGTGTTCAAGGG - Intronic
916653020 1:166848470-166848492 TAGGTTTTCTTGGTTCTAAAGGG + Intronic
916713761 1:167433469-167433491 AAGGTCTTCTAGCTGGTAAACGG - Intronic
919051860 1:192521400-192521422 CAGGTGTCCTAGGTAATAAATGG - Intergenic
919265161 1:195253311-195253333 CAGGTGTTTTAGGTTTTAAATGG + Intergenic
922745536 1:228041334-228041356 AGGGAGTTCTAGGTGGTAAGAGG - Intronic
924122397 1:240814558-240814580 AAGTTTTTCTATGTGCAAAAAGG + Intronic
924837481 1:247666986-247667008 CAGGTGTTCTTGGTGCGAAGTGG + Intergenic
1068285839 10:54933645-54933667 AAGGTTTTCTTGGTGGGAAATGG - Intronic
1068444204 10:57099195-57099217 AAGGTGTTCTAAGTACTTTACGG + Intergenic
1072830161 10:98648944-98648966 AGGATGTTCTAGGTGGTAAGGGG - Intronic
1072853601 10:98924051-98924073 AAGGTTTTCTAGGTATTCAAAGG + Intronic
1074957529 10:118406859-118406881 AATGGGTTCTAGTTACTAAAAGG - Intergenic
1076912837 10:133400578-133400600 AGGGTGTTTTTGGTGCTAATTGG + Intronic
1077916506 11:6615102-6615124 AAGGTGTTCAAGGTGTTAGGGGG + Intronic
1081605654 11:44525780-44525802 AAGGTGTTGGAGGAGCTGAAAGG + Intergenic
1086194418 11:84120189-84120211 AAGGTTTTATAGTTGATAAATGG - Intronic
1088164476 11:106916972-106916994 ATGTTGTTCTAGGAGCTAACTGG + Intronic
1090751008 11:129746565-129746587 AAGGTGTTCTGGGTGAAACAGGG + Intergenic
1092049841 12:5460640-5460662 AAGGTGTCCCAGGTGGTGAAAGG - Intronic
1093038306 12:14353707-14353729 AAGGTATTTAAGGTGCTACATGG + Intergenic
1094578918 12:31715177-31715199 ATGTTGTTTTAGGAGCTAAAGGG - Intronic
1097008743 12:55937670-55937692 AGGCTGGTCTAGGAGCTAAAGGG + Intronic
1097515648 12:60602036-60602058 AATATGTTCAAAGTGCTAAAAGG + Intergenic
1098535967 12:71593829-71593851 AAGGTTATCCAGGTGGTAAATGG - Intergenic
1100247474 12:92775779-92775801 AAGCTATTCCAGGGGCTAAATGG + Exonic
1101239761 12:102826054-102826076 AATCTGTTCTCGCTGCTAAAAGG + Intergenic
1101797950 12:107993282-107993304 AAAGTTTTCCAGGTGCTAAATGG - Intergenic
1107202956 13:37744287-37744309 AAGATGTTCAAAGTGGTAAATGG - Intronic
1108187697 13:47904736-47904758 AAGGTATTCAAGATGATAAAGGG - Intergenic
1116207836 14:41890883-41890905 GAGGTATTGTAAGTGCTAAATGG + Intronic
1116633704 14:47365640-47365662 CAGGTGTTCTAGATAGTAAATGG + Intronic
1116637063 14:47410195-47410217 ATGCTTTTCTTGGTGCTAAATGG - Intronic
1117252743 14:53952775-53952797 AAGGTGGTCTGGGAGCTAACCGG + Intronic
1119343897 14:73905459-73905481 AACCTGTTCTAGGCACTAAATGG + Intronic
1120673234 14:87388331-87388353 AAGATGTTCTAGGTTAAAAAGGG + Intergenic
1125240304 15:37566429-37566451 AACATGTTGTAAGTGCTAAAAGG + Intergenic
1127429723 15:58892006-58892028 AATGGGTTCTATGTGCTACAAGG + Intronic
1128585515 15:68846257-68846279 AAGGTGTGCTTGGTGCTACTTGG - Intronic
1130862481 15:87903424-87903446 AAGGGGTTGTAGGAGCTACAGGG - Intronic
1134270816 16:12731509-12731531 TAAGTGTTCTAGGAGCCAAATGG - Intronic
1134414456 16:14031531-14031553 AACATTTTCTATGTGCTAAAAGG - Intergenic
1143346613 17:6254116-6254138 AAGGTGTGCAAGGAGCTGAAAGG - Intergenic
1145094400 17:20012433-20012455 AAGCTGTTTTATGTGCTTAAAGG + Intronic
1145353123 17:22106704-22106726 AATGAGTTCTAGGTGTTAAAAGG + Intergenic
1146753257 17:35401586-35401608 AGGGTGTTCTATGGCCTAAATGG - Intergenic
1150927730 17:69551304-69551326 AAGGTGTTGTAGGTGGAGAAGGG + Intergenic
1153357401 18:4152631-4152653 AAAGTGTTGTGGGTGGTAAAAGG + Intronic
1154366457 18:13714120-13714142 AATTTGTTCTAGGTGCCAAAAGG - Intronic
1154436319 18:14344691-14344713 ATGGTCTTCAAGGTGCTAACTGG + Intergenic
1155833364 18:30546049-30546071 AAGACGTTCTAGGTGCCTAATGG + Intergenic
1157223390 18:45842507-45842529 CAGGTGTTCTAGGTAAGAAAGGG - Exonic
1158265432 18:55656283-55656305 AAGCAGTTCTAGGTGTTCAAAGG - Intronic
1164474898 19:28568297-28568319 AAGGTGTTCTAGAAGCTCAGAGG - Intergenic
1165400572 19:35597061-35597083 AAGGTCTTAGAGGAGCTAAAGGG + Intergenic
926088295 2:10033582-10033604 GAGCTGATCTAGGTGCTGAAAGG + Intergenic
927918550 2:26952724-26952746 AAGGTGTTCAAGTTCATAAATGG - Intergenic
928637768 2:33265861-33265883 AATGTGTTATAGGAGCTAAATGG + Intronic
931596999 2:63958241-63958263 AAGGTGTTCTGGGAGCTCAGAGG + Intronic
933333191 2:80921052-80921074 AAGGTTTTCCAGGTATTAAAGGG + Intergenic
933380503 2:81537226-81537248 AGGGTGTCCTGGGTGCTAAACGG - Intergenic
933621028 2:84541569-84541591 AAGATTTTCTATGTGCTAAAGGG + Intronic
935840506 2:107104543-107104565 AATGTGTTCAAGGAGCTAAGGGG - Intergenic
935943624 2:108267359-108267381 AAGCTGTTCCAAGTGCTAAGAGG - Intergenic
939830858 2:147069086-147069108 AAGAGTTTCCAGGTGCTAAAGGG - Intergenic
943035774 2:182744312-182744334 AAGCAGTGCTAGGTGCTAATGGG - Intronic
944118072 2:196210227-196210249 AAGATGTTCCATGTGATAAACGG + Intronic
944991307 2:205239247-205239269 AAGGTGTTCTAGGTGCTAAAAGG + Intronic
946461770 2:219875310-219875332 GAGGTGTTTTAGGTGCTAAAAGG + Intergenic
1171563360 20:26150901-26150923 AATGAGTTCTAGGTGTTAAAAGG + Intergenic
1175135064 20:56816975-56816997 AAGGTGTTCCAAGTGGCAAAAGG + Intergenic
1175368302 20:58470379-58470401 TAGGTGTTCAAGGTGTTGAATGG + Intronic
1183874375 22:40766518-40766540 AAAGTTTTCTAGGGGCTAAGTGG - Intergenic
1184318944 22:43724133-43724155 AAAGTGTTCAAGGTGCTGCATGG - Intronic
953519857 3:43631531-43631553 TAGGTGTTCCAGCTACTAAAAGG + Intronic
956769585 3:72513472-72513494 AAGGTGTCCTAGTTGCTAGGTGG + Intergenic
957571700 3:81955051-81955073 AACTTATTCTAAGTGCTAAAAGG + Intergenic
960173223 3:114487581-114487603 AAGCTGTTCTGGGTGGTAATTGG - Intronic
961626822 3:128269750-128269772 AAACTGTTCTAGGGACTAAATGG - Intronic
962457969 3:135582752-135582774 AAGCTGGTCTAGCTGCTAAGTGG - Intergenic
966029349 3:175326075-175326097 AAAGTGTTCAAGGTGCTACATGG - Intronic
969879627 4:10162413-10162435 AATGTGTTCTAGGTGGTTCATGG + Intergenic
969949263 4:10817258-10817280 AAGGTTTTCCAGTTGCTCAATGG + Intergenic
970093929 4:12441127-12441149 AAGGTTTTCTAACTGCTAAGTGG + Intergenic
970834480 4:20385636-20385658 AAGAAGTTTTAGGTGATAAAGGG + Intronic
983769204 4:171527008-171527030 ACTGTATTCTAGGTGGTAAATGG - Intergenic
991285400 5:64969747-64969769 AAAGTGTGATAAGTGCTAAAGGG + Intronic
992007092 5:72488705-72488727 AAAGTGTTCTTGGGGCTTAAGGG - Intronic
992306551 5:75445829-75445851 AATGTATTCAAAGTGCTAAAAGG - Intronic
992378817 5:76217017-76217039 AAGGTGTTCAATTAGCTAAATGG + Intronic
993636841 5:90354510-90354532 AAAGTGTTCCTGATGCTAAAAGG - Intergenic
996056269 5:118986235-118986257 AAGGTATTCTAAGAGGTAAATGG + Intronic
996915082 5:128702796-128702818 AAAGGGTTCTAGGTGCTGCATGG + Intronic
999590974 5:153145201-153145223 AAGGAGTTCTAGGCTTTAAAAGG + Intergenic
1001731470 5:173963713-173963735 AAGGTGATACAGGAGCTAAAAGG + Intergenic
1003004333 6:2367046-2367068 AGGCTGTTCTAGGTGCCAAGAGG + Intergenic
1003264505 6:4553390-4553412 AGGGGGCTCTAGGTGGTAAATGG + Intergenic
1003264936 6:4557314-4557336 AAGATGCTGTAGGTGCTAAGAGG + Intergenic
1006333555 6:33409292-33409314 AAGGAGTCCTAGTTCCTAAATGG + Intronic
1007213555 6:40217971-40217993 AAGGTGTTCTGGGTGATCCAAGG - Intergenic
1008286147 6:49653586-49653608 AAGGTATACTTGGTACTAAAGGG - Intergenic
1013954754 6:115828122-115828144 AAGGTCTTCTAGGTAGGAAAAGG - Intergenic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1019618438 7:1977747-1977769 GAGAGGTTCTAGGTGCCAAAAGG + Intronic
1022650624 7:32270777-32270799 AAGGTGGTTAAGCTGCTAAATGG - Intronic
1025274354 7:57563470-57563492 AATGAGTTCTAGGTCTTAAAAGG - Intergenic
1026965679 7:74438173-74438195 AAAGTGTTCAGGGTGCTACATGG - Intergenic
1030401257 7:109053472-109053494 AAGGAGTTCTAGGAAATAAATGG - Intergenic
1031061499 7:117056254-117056276 AAGCTGTGCCAGGTGATAAAAGG + Intronic
1033656458 7:143378369-143378391 AAGATGTTTTAGGTAGTAAAGGG + Intergenic
1036282468 8:7413259-7413281 AAGGAGTTCTGGGTTCCAAAAGG - Intergenic
1036339003 8:7898290-7898312 AAGGAGTTCTGGGTTCCAAAAGG + Intergenic
1036724857 8:11210819-11210841 AAGGTGATATAGCTGGTAAATGG - Intergenic
1037340619 8:17840679-17840701 AAGGTGTTTGAGGTGAAAAAAGG - Intergenic
1038498980 8:28027553-28027575 AAGGGGTTTTAGTTGATAAAAGG - Intronic
1038535595 8:28350928-28350950 AAGGTGTTGTAGGTACCAGAGGG - Intronic
1043219023 8:77635165-77635187 TAGGTGTTCTAGGAGAGAAATGG - Intergenic
1043946046 8:86253796-86253818 AAAGTATTCAAGGTGCTATATGG - Intronic
1046466860 8:114616040-114616062 AAAGTGTTCTAGGTAAAAAAAGG - Intergenic
1047431815 8:124799431-124799453 AAGGGGCTTTAGGTGCTCAAAGG - Intergenic
1048061141 8:130920343-130920365 ACGGTGTTTTTGGTTCTAAATGG - Intronic
1048535490 8:135290602-135290624 AAGATTTTCCAGGTGCCAAAAGG - Intergenic
1048698355 8:137055038-137055060 AAGTTGTTTTAGGTGATCAAAGG + Intergenic
1051270999 9:15354709-15354731 AAGGTGGTCAAGGTGCAACATGG + Intergenic
1051347954 9:16169529-16169551 AAGGTTATATAGGTACTAAATGG + Intergenic
1052589232 9:30469664-30469686 AAGGTTTTGTAGCTGATAAATGG + Intergenic
1055228693 9:74033305-74033327 AAGGTGTTATATGTGCCATATGG - Intergenic
1055590977 9:77813615-77813637 CAGGTGTCCTAGGTGCAAAGAGG + Intronic
1056091367 9:83208757-83208779 AAGTTGTTCTGGGAGCTTAAAGG + Intergenic
1056516890 9:87360433-87360455 AAGGCGTTCTAGGTATTCAAAGG - Intergenic
1057828739 9:98391349-98391371 ATGGTTTTCTAGGTGTTAAGTGG + Intronic
1059679014 9:116568225-116568247 AAGGTTTTCTACCTGCTAAATGG - Intronic
1189711942 X:43822331-43822353 AAGGTTTTCTTGGTCCCAAAAGG + Intronic
1192128364 X:68524080-68524102 TAGGTGTTCTAAGTGGGAAATGG + Intronic
1193756634 X:85417689-85417711 AAGGTTTTCTAGGTATTCAAAGG + Intergenic
1194387912 X:93279181-93279203 AAGGTGTTCCGGGTACTCAAAGG - Intergenic
1194827724 X:98583153-98583175 AAGGTGTTCTAGGTGCATATAGG + Intergenic
1195684798 X:107575847-107575869 GAGGTGTTCTGGGTGTTACAGGG + Intronic
1197403167 X:126018680-126018702 AAGGTTTTCTAGGTGTTTGAAGG + Intergenic
1199007076 X:142713008-142713030 AAGGTTTTCTTGTTGATAAATGG + Intergenic
1199426406 X:147706211-147706233 AAGGTGTTTAAGTTGGTAAATGG + Intergenic
1201372424 Y:13279580-13279602 AAGGTTTTCTAGGTATTCAAAGG - Intronic
1202015815 Y:20405427-20405449 GAGGTTTTCTAGGTGCTATCTGG + Intergenic