ID: 944996519

View in Genome Browser
Species Human (GRCh38)
Location 2:205300968-205300990
Sequence TGGTCCTTGTAGAAAAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 177}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944996519_944996522 -3 Left 944996519 2:205300968-205300990 CCTTCACTTTTCTACAAGGACCA 0: 1
1: 0
2: 0
3: 8
4: 177
Right 944996522 2:205300988-205301010 CCAACTGTCATTTACCCTTAGGG 0: 1
1: 0
2: 0
3: 9
4: 107
944996519_944996520 -4 Left 944996519 2:205300968-205300990 CCTTCACTTTTCTACAAGGACCA 0: 1
1: 0
2: 0
3: 8
4: 177
Right 944996520 2:205300987-205301009 ACCAACTGTCATTTACCCTTAGG 0: 1
1: 0
2: 1
3: 21
4: 179
944996519_944996523 1 Left 944996519 2:205300968-205300990 CCTTCACTTTTCTACAAGGACCA 0: 1
1: 0
2: 0
3: 8
4: 177
Right 944996523 2:205300992-205301014 CTGTCATTTACCCTTAGGGTAGG 0: 1
1: 0
2: 0
3: 10
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944996519 Original CRISPR TGGTCCTTGTAGAAAAGTGA AGG (reversed) Intronic
904503251 1:30929869-30929891 TGGTCCTTGTAGAAAGCTTTAGG - Intergenic
907211830 1:52830334-52830356 ATGTCCTGGTAGAAGAGTGAAGG + Intergenic
907830142 1:58057035-58057057 GGGTCCTAGTAGAAAATAGAAGG - Intronic
909003117 1:70242722-70242744 TAGTAAGTGTAGAAAAGTGACGG + Intronic
910506736 1:87958168-87958190 TGTTACTTCTAGAAAAGTTAAGG - Intergenic
911382697 1:97135826-97135848 TGGACCTTGTTAAAAAATGATGG + Intronic
912936153 1:114005186-114005208 TAGTGGCTGTAGAAAAGTGAAGG + Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
922759018 1:228113558-228113580 ATGTCCTTTTAGAAAAGTGAAGG + Intergenic
924630744 1:245738141-245738163 TGGTCTTAGTAGATCAGTGAAGG + Intergenic
1067360628 10:45574878-45574900 TAGTCCTTTTGGAAGAGTGAGGG - Intronic
1069690668 10:70349748-70349770 TGGTCATTGTGGTACAGTGATGG + Intronic
1072449307 10:95526743-95526765 TGGACCTTCCAGAACAGTGAAGG - Intronic
1078096661 11:8301528-8301550 TTGTCCTTGGAGAAAAGCTAGGG + Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078423070 11:11228253-11228275 TGGGATTTGTAGAAAAGTCAGGG + Intergenic
1081555815 11:44160047-44160069 TGGTGCTTCTAGAAAGGGGAAGG - Intronic
1082187584 11:49203576-49203598 TGGTCCTTGGAGGAATGAGAGGG + Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083132858 11:60642407-60642429 TGGACCTTCTAGAAAACTGAAGG - Intergenic
1086124017 11:83331273-83331295 TGGTCCTTCTTGACAAGGGAAGG + Intergenic
1086899015 11:92345301-92345323 AGCTCCTTGAAGAAAAGTTATGG - Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087708846 11:101526178-101526200 TGGTCATTGTTAAAAAGAGAAGG - Intronic
1089140877 11:116282944-116282966 CTGTCCTGGAAGAAAAGTGAAGG + Intergenic
1089504536 11:118954753-118954775 GGGTCCTGGTAGGAATGTGAGGG - Intronic
1089923304 11:122230840-122230862 TGGCTCTTGAAGAAAAGAGAGGG + Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090536223 11:127644772-127644794 AGGTACTTGTAGAAAACTGAGGG + Intergenic
1090712923 11:129404086-129404108 TGGTCCTTGTTGAAAATTTCAGG - Intronic
1091312058 11:134581607-134581629 TGGTCCTTTTAAAGAAGTGTGGG + Intergenic
1092306343 12:7304786-7304808 TGGGGCTTGGAGAAAAGAGAAGG - Intronic
1092781837 12:11994800-11994822 TTGCCCTTGGAGAAAGGTGAAGG - Intergenic
1092910930 12:13144452-13144474 TGGTTCATGTAGAGAAGTAATGG + Intergenic
1093358773 12:18199450-18199472 TAGTCCTTTTACAAGAGTGAGGG - Intronic
1095645817 12:44544933-44544955 CAGTCCTTGGAGAAAACTGAGGG + Intronic
1095857144 12:46872774-46872796 TGGATCTTGTGGAAACGTGATGG + Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097819332 12:64112164-64112186 GAGTCCTTGGAGAAAAGAGAGGG - Intronic
1100420650 12:94429694-94429716 TAGTCCTGGTAGCACAGTGATGG - Intronic
1100648963 12:96563755-96563777 TGGTCCTTGGAGATATGCGAGGG - Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1102617846 12:114170135-114170157 TGGTCCTTGGAGATGAGTTAAGG - Intergenic
1102682594 12:114700615-114700637 TGCTCCTTGTAGATCAGAGAAGG + Intergenic
1104135056 12:125929891-125929913 TGGTCCTTCTTGAAAAATCACGG - Intergenic
1105662801 13:22517305-22517327 AGATCTTTGTACAAAAGTGATGG + Intergenic
1106464686 13:30002540-30002562 TGCTCCTGGTGGCAAAGTGAAGG + Intergenic
1107240508 13:38228599-38228621 AGGTCTTTGTAGAAAGGAGATGG + Intergenic
1108345599 13:49543667-49543689 AGTTCCTTGTATAAATGTGAGGG - Intronic
1112359666 13:98706034-98706056 TGGTCCTTGTATAAATGCCAAGG - Intronic
1116234949 14:42268088-42268110 ATGCCCTTCTAGAAAAGTGAAGG + Intergenic
1122160765 14:99782206-99782228 TGCTCAAAGTAGAAAAGTGAGGG + Intronic
1125417621 15:39469904-39469926 TGGTACTTGGAGAAAAGAAAAGG - Intergenic
1126943367 15:53790401-53790423 TGGTAGTGGTAGAAAAGTAAAGG + Intergenic
1127626596 15:60786287-60786309 TGCTCCTTGTTGAAAGGTCAGGG + Intronic
1128324820 15:66717483-66717505 TGGCCCTTGCAGAAAAGTGGGGG - Intronic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1130241477 15:82197141-82197163 TTGTCATTTTAGAAAATTGAAGG + Intronic
1133119623 16:3598082-3598104 TGGGCCTGAGAGAAAAGTGACGG + Intronic
1137870435 16:51945067-51945089 TAGTCCTTGAAGAAATGTTAGGG - Intergenic
1140573962 16:76141402-76141424 TTGTCCCTCTAGAAAAGAGATGG + Intergenic
1140625727 16:76792298-76792320 TTTTACTTGTAGGAAAGTGAAGG - Intergenic
1140941480 16:79725463-79725485 AGTTCCTTGTACAAAAGAGATGG + Intergenic
1145231157 17:21174317-21174339 TTGTCCTTGTAGAATAGTGTGGG + Intronic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1155999891 18:32372858-32372880 TGGTTCCTGTAGAAAACTGGGGG + Intronic
1156038768 18:32795136-32795158 TGATCATTGTAAAAAAGAGAAGG - Intergenic
1159472468 18:68875349-68875371 TTGTCCTTGTAGAAAGGAGAAGG + Intronic
1164461337 19:28451388-28451410 ATGCCCTTTTAGAAAAGTGAAGG - Intergenic
1168526224 19:57090686-57090708 GGGTCTTTGCAGAAGAGTGAAGG + Intergenic
927134431 2:20086345-20086367 TGGTCCTTTTGCAAGAGTGAGGG - Intergenic
928118244 2:28563487-28563509 TTGTCCATGTAGAAAAGCTAAGG + Intronic
929197822 2:39204734-39204756 AAGTTCTTTTAGAAAAGTGAAGG - Intronic
930271657 2:49264358-49264380 GGCTCATTGTAGAAAAGGGATGG + Intergenic
930508892 2:52319445-52319467 TGGACCTAGTAGCAAAGTGGAGG + Intergenic
931623382 2:64233137-64233159 AGGTCCTTGTGAAAAAGGGATGG + Intergenic
934772206 2:96914191-96914213 TAGTCCGTGGAGAAAAATGAAGG + Intronic
937239837 2:120452968-120452990 TGGACCTTCTAGAAAAAGGAGGG - Intergenic
938625365 2:133103159-133103181 TCATTCATGTAGAAAAGTGATGG - Intronic
938663060 2:133506859-133506881 TTGTCTTTGTAGACAAATGATGG + Intronic
942050341 2:172134287-172134309 TGGTCACTATAGAAAAGTAAAGG + Intergenic
943218479 2:185072129-185072151 TGGTCCTGGAAGAAAAGAAAAGG + Intergenic
944996519 2:205300968-205300990 TGGTCCTTGTAGAAAAGTGAAGG - Intronic
946275450 2:218628268-218628290 GGGACCATGTAGAAAAGTGAGGG + Intronic
947849562 2:233274730-233274752 TGGTTCTGGTAAAGAAGTGAGGG + Exonic
948643667 2:239390722-239390744 GGCTCCTGGTAGCAAAGTGAGGG - Intronic
1169006631 20:2212891-2212913 TGCTCCTGGGAGAAAAGAGAAGG - Intergenic
1170137498 20:13091032-13091054 TTGGCCTTGTTGAAAAGAGAAGG + Intronic
1170650759 20:18238941-18238963 TGATCTTTGGAGAAAAATGATGG + Intergenic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1173227009 20:41168013-41168035 TGGTCTTTGTGGAGAAGTGGTGG + Intronic
1174723157 20:52835102-52835124 TGCTTCTTTTAGAAAAATGAGGG - Intergenic
1177391771 21:20484315-20484337 TGGTCATGGTGGTAAAGTGATGG + Intergenic
1179381601 21:40904196-40904218 AGGTCCTGCTAGAAAAGGGAGGG - Intergenic
1180061607 21:45388191-45388213 TGGTCCTGGGAGAAGAGGGAAGG + Intergenic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1183618053 22:38956884-38956906 TGGGCCCTGCAGAAATGTGAGGG - Intronic
950708668 3:14799918-14799940 TTGTCCTTTTAGTAAAATGAAGG + Intergenic
951137053 3:19116660-19116682 TGGTCGTTATAAGAAAGTGAAGG - Intergenic
951187212 3:19727649-19727671 ATGTCCTTGTGGAAGAGTGAAGG - Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951279491 3:20731283-20731305 TTGTTCCTGTGGAAAAGTGAAGG - Intergenic
953435093 3:42871657-42871679 TGGTCCTTGTAGAATAGGATGGG + Intronic
955567409 3:60262385-60262407 CTGTGCTTGCAGAAAAGTGATGG + Intronic
955739834 3:62078646-62078668 GGGTCTCTTTAGAAAAGTGACGG - Intronic
956003065 3:64749598-64749620 TGGAACTTTTACAAAAGTGAGGG + Intergenic
961427012 3:126856340-126856362 TGTTCCTTGTAGATAAGGAATGG + Intronic
962568391 3:136687697-136687719 TTGTCTTTCTAGAAAAATGAAGG + Intronic
964762731 3:160149767-160149789 TGCTCCTTGAACAAAAGTTATGG - Intergenic
964781515 3:160344059-160344081 GGCTCCTTGTAGAACATTGATGG - Intronic
965969174 3:174532571-174532593 GGGTGCTTATAGAATAGTGAGGG + Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
970822723 4:20237689-20237711 TGTTCCTTGTAGAAGACTGAGGG - Intergenic
971176643 4:24288689-24288711 TTGTTCTTGTAGAAAAATGCTGG - Intergenic
971490299 4:27205159-27205181 TGATCCTTAGAGAAAAATGAGGG + Intergenic
973149097 4:46865463-46865485 TGGTCCTTTTACAAAGGTAATGG - Intronic
976385363 4:84451246-84451268 TGGACCATGTAGAAGATTGAAGG + Intergenic
977857558 4:101912256-101912278 GGGTCCTTTTAGAAAGGGGAGGG - Intronic
978955117 4:114603017-114603039 AGGTCCTTGTACCAAAGTGTTGG + Intronic
982502256 4:156171770-156171792 TGTTCGTTGTAGAAAATTTAGGG - Intergenic
983421637 4:167526329-167526351 TGGTCCTTGTAGAATTGTAGAGG + Intergenic
984074774 4:175162533-175162555 TGTTCATTTTAGAAAAGTTAGGG + Intergenic
984553528 4:181187452-181187474 TTGTACTTCTAGAAAACTGAAGG + Intergenic
985121933 4:186652150-186652172 TGTTTCTTGTTGAAAATTGATGG + Intronic
986206769 5:5631851-5631873 GTGTCCTTGTAGGAAAGTGCCGG - Intergenic
989120014 5:37995646-37995668 TGCTACTTCTAGAAAGGTGAGGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989397808 5:40977338-40977360 TGGTCCTAGTAGGATAGAGATGG + Intronic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
991243612 5:64486069-64486091 TGGCTCTTGAAGAAAAGAGATGG - Intergenic
991458132 5:66826662-66826684 TGGTCCTTCTAGAAAAACTAGGG - Intronic
994022924 5:95048848-95048870 TCCTCCTTGTAGAAAAGAAAGGG + Intronic
996805185 5:127446711-127446733 AGGCCCTTTTAGGAAAGTGAAGG + Intronic
1001322220 5:170692077-170692099 TGGTTCTTGGGGAAAATTGAGGG - Intronic
1005328458 6:24724909-24724931 GGCTCTTTTTAGAAAAGTGAAGG - Intergenic
1007193780 6:40041571-40041593 GGGTCCTCGGAGAAAAGAGATGG - Intergenic
1012601277 6:101100299-101100321 TGGAATTTGTAGAAAAGTAAGGG + Intergenic
1013094309 6:106930359-106930381 GGATCCTTTTAGAAAAGAGAAGG - Intergenic
1016798240 6:148141185-148141207 TAGTTCTTTTAGAAAAGTTAGGG - Intergenic
1019140948 6:169942041-169942063 ACGTCCTTCCAGAAAAGTGAGGG - Intergenic
1020093469 7:5354460-5354482 TGCTCATTTTGGAAAAGTGAAGG - Intronic
1020529553 7:9314798-9314820 TGTTTCTTGAAGAAACGTGATGG + Intergenic
1021889371 7:25172563-25172585 AGGTCCTTAGAGAAAAATGAGGG + Intronic
1023038234 7:36151812-36151834 GGTTCCTTGTTGAAAAGTTAAGG - Intergenic
1029580500 7:101433888-101433910 TGGTCCATGTAGTAAAGTCCTGG - Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030980942 7:116185242-116185264 TTTTCCTAGTAGAAAAATGATGG + Intergenic
1031158742 7:118141274-118141296 TGTTCCTTGCACAGAAGTGAGGG - Intergenic
1031738070 7:125392379-125392401 TGGTCCTTTTAGACAAGTCCTGG + Intergenic
1032371005 7:131351721-131351743 TGGTCTTTCTAAAAAACTGATGG - Intronic
1033520728 7:142157919-142157941 TGGTCCTAGGAGAAAATGGAAGG - Intronic
1041556703 8:59165280-59165302 TGGTCCTGGGAGACAAGTGGAGG + Intergenic
1041703278 8:60815813-60815835 TGGTCCTTCTAGAAAAATCTAGG - Intronic
1042782038 8:72502122-72502144 TGGTTCTTGAAGAAAATTGCAGG + Intergenic
1045533099 8:103002750-103002772 TAGTCCTTTTACAAGAGTGAGGG - Intergenic
1045851549 8:106704752-106704774 GCATCCTTGTAGAACAGTGATGG - Intronic
1046337438 8:112808447-112808469 AAGTCCTTGAAGAAAAGTGGGGG - Intronic
1046648356 8:116810014-116810036 TGGTCCTGGTAGGAAAGCAAAGG + Intronic
1047028333 8:120849131-120849153 AGCTCCTTTTAGAAAAATGAAGG - Intergenic
1049925750 9:405736-405758 TGATACTAGTACAAAAGTGAAGG + Intronic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051126871 9:13814646-13814668 TGGTGCTTTGAGGAAAGTGAGGG - Intergenic
1051152573 9:14099704-14099726 TGTTCAATGTAGAAATGTGATGG + Intronic
1055157361 9:73080463-73080485 TGTGCCTTGTGGAAAAGAGAAGG - Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056076756 9:83049424-83049446 TGGTCTAAATAGAAAAGTGATGG - Intronic
1056918385 9:90763981-90764003 TTCTCCTTGCAGAAAGGTGAAGG + Intergenic
1057760158 9:97866463-97866485 TCTTCATTGTATAAAAGTGATGG + Intergenic
1062466787 9:136685135-136685157 TGGTCCCTGAAGAGAAGGGAGGG - Intronic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1187263483 X:17709115-17709137 TGGTCTTTGGAGAAGAGAGATGG + Intronic
1188328511 X:28837843-28837865 TGGGGCTTGGAGAAAAATGATGG - Intronic
1193471526 X:81909699-81909721 TGGTCCTTGTAGGAACTAGATGG + Intergenic
1194228086 X:91286784-91286806 TGCTGCTTGTAGAAAGGGGAAGG + Intergenic
1196306295 X:114107227-114107249 TGGCCCTGTGAGAAAAGTGAGGG - Intergenic
1197500029 X:127230922-127230944 TAGTCCTTTTACAAGAGTGAGGG - Intergenic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1198875581 X:141222377-141222399 TAGTTCTTGTAGTAAACTGATGG - Intergenic
1199732584 X:150650999-150651021 TGGTCCTTGAAGAAAGTGGAAGG - Intronic
1200734268 Y:6776901-6776923 TTGCCCTTTTAGAATAGTGAAGG + Intergenic
1201598386 Y:15698394-15698416 TGGTCATTTTAGAAAACTGTTGG + Intergenic