ID: 945000229

View in Genome Browser
Species Human (GRCh38)
Location 2:205342117-205342139
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 255}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945000225_945000229 8 Left 945000225 2:205342086-205342108 CCTCTAGCACAGTGTCTGACAGA 0: 1
1: 1
2: 7
3: 70
4: 444
Right 945000229 2:205342117-205342139 CTGTATGACTAAAGGGAGGAAGG 0: 1
1: 0
2: 2
3: 20
4: 255
945000224_945000229 14 Left 945000224 2:205342080-205342102 CCTCAGCCTCTAGCACAGTGTCT 0: 4
1: 2
2: 37
3: 279
4: 1258
Right 945000229 2:205342117-205342139 CTGTATGACTAAAGGGAGGAAGG 0: 1
1: 0
2: 2
3: 20
4: 255
945000223_945000229 30 Left 945000223 2:205342064-205342086 CCACTGTCTGTTGTATCCTCAGC 0: 1
1: 0
2: 2
3: 14
4: 191
Right 945000229 2:205342117-205342139 CTGTATGACTAAAGGGAGGAAGG 0: 1
1: 0
2: 2
3: 20
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901922188 1:12545268-12545290 TTGAATGAATGAAGGGAGGAAGG - Intergenic
902628584 1:17691101-17691123 CTGTCTGGTTAAAAGGAGGAGGG - Intronic
903480887 1:23652471-23652493 CGGGAGGACTGAAGGGAGGAGGG + Intergenic
903519215 1:23934758-23934780 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
904977922 1:34472703-34472725 CTGTGTGAATCAAGGGAGGATGG + Intergenic
905226883 1:36484755-36484777 CTGCATGACTAGGGAGAGGAGGG - Intergenic
905929421 1:41776840-41776862 CTGTAAGAGTGAAGGGAGGGAGG - Intronic
909849364 1:80440984-80441006 CTGTATGACTAAAGGAATTCAGG - Intergenic
911184230 1:94887330-94887352 CTGAATGAATAGGGGGAGGAGGG - Intronic
911762400 1:101631379-101631401 CTGCTTGAATAAAGGAAGGAAGG - Intergenic
913329709 1:117657066-117657088 ATGAATGAATAAAGGAAGGAAGG - Intergenic
913701597 1:121379772-121379794 CTCTATGGCCAAAGGGAGGCTGG - Intronic
914042157 1:144060240-144060262 CTCTATGGCCAAAGGGAGGCTGG - Intergenic
914135932 1:144900247-144900269 CTCTATGGCCAAAGGGAGGCTGG + Intronic
914679425 1:149928561-149928583 GTGTATGACCCAAGAGAGGAAGG - Intergenic
915045451 1:153010149-153010171 AAGAATGACTAAAGGGAGGAAGG - Intergenic
917502441 1:175598118-175598140 CTGTTTGACTAATGCAAGGACGG - Intronic
917530767 1:175833060-175833082 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
918038573 1:180898306-180898328 CTGGATGCCTAATGGGAAGAAGG - Intergenic
918187754 1:182142989-182143011 CTGAATTCCTAAGGGGAGGAAGG + Intergenic
919472777 1:197999484-197999506 TTGTATGAAAAAAGGCAGGATGG + Intergenic
919596555 1:199570838-199570860 CTGAATCCCAAAAGGGAGGAGGG - Intergenic
920049263 1:203153541-203153563 CTGCAGGGCTACAGGGAGGAGGG - Intronic
920228076 1:204452220-204452242 CTGTATGAGTAAAGGGTTTAAGG + Intronic
920489023 1:206398492-206398514 CTCTATGGCCAAAGGGAGGCTGG - Intronic
921026930 1:211293169-211293191 CTGTAGGAATGAAGGAAGGATGG - Intronic
921411094 1:214836926-214836948 CTGAATGAATGAAGAGAGGAGGG - Intergenic
921558010 1:216622455-216622477 CTGTATTCCTAAAGGGCTGAAGG - Intronic
922211926 1:223492984-223493006 CTAAGTGACTAAAGGGTGGATGG + Intergenic
922337385 1:224628784-224628806 CTGAATTCCAAAAGGGAGGAGGG - Intronic
923788306 1:237089580-237089602 CTGTATCCCTCAAGGGAGGCTGG - Intronic
924259941 1:242219438-242219460 CTGGATGACTAATGGAAAGATGG + Intronic
1062900313 10:1139458-1139480 ATGTATGACCAAAGTGGGGAAGG + Intergenic
1065012510 10:21432371-21432393 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1065711897 10:28526327-28526349 CAGTATGACTTAAGGGTGAAGGG - Intergenic
1065838848 10:29683448-29683470 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1066055952 10:31680203-31680225 GTGTATGACCAGAGGGAAGAGGG + Intergenic
1067695911 10:48535560-48535582 CTGTCTTACTGCAGGGAGGATGG + Intronic
1068076188 10:52257609-52257631 CTCTGTGACTAAAGTGAGTAAGG + Intronic
1068458268 10:57289243-57289265 CTGTATGACATAAGGCAGAAAGG + Intergenic
1071959463 10:90796080-90796102 CTGAATTCCAAAAGGGAGGAAGG + Intronic
1072588145 10:96800537-96800559 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1073360491 10:102894584-102894606 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1073439267 10:103543152-103543174 CTGCAGGACTACAGGGAGGAGGG - Intronic
1074184109 10:111086391-111086413 TTGAATGAATAAAGGAAGGAAGG - Intergenic
1076977336 11:184251-184273 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1077847944 11:6045887-6045909 CAGGAGGACTAAAGGGATGAAGG + Intergenic
1078179129 11:8995829-8995851 CTGAATGAATAAAGGGAGAGTGG - Intronic
1080812144 11:35715464-35715486 ATTTATGACTATATGGAGGAGGG + Intronic
1081907897 11:46680748-46680770 CTGTAGGAGTAGAGGGAGGTGGG + Intronic
1083389772 11:62339351-62339373 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1083621625 11:64052110-64052132 CTTTCTCACTACAGGGAGGAGGG - Intronic
1085261638 11:75208857-75208879 CTGAATGAATGAAGGAAGGAAGG - Intergenic
1087166100 11:95004802-95004824 CAGAATGAATAAAGGAAGGAAGG - Intergenic
1087807638 11:102572297-102572319 CAGAATAACTAAAGGGAGGGAGG - Intergenic
1088313764 11:108486918-108486940 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1088458359 11:110056658-110056680 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1090096961 11:123751911-123751933 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1090185281 11:124735004-124735026 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1090880244 11:130826444-130826466 ATGAATGAATAAAGGGATGAAGG - Intergenic
1091104254 11:132903554-132903576 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1093293723 12:17361707-17361729 CTTTCTGACTAAAGGTAAGATGG + Intergenic
1093429446 12:19067700-19067722 ATGAATGAATAAAGGAAGGAGGG + Intergenic
1093449439 12:19298282-19298304 CTGTAAGACTAAATGGATAATGG + Intronic
1093517204 12:20002701-20002723 CTGAATGACTATGGGGAGAAAGG - Intergenic
1094527892 12:31244901-31244923 CTGTGATCCTAAAGGGAGGAAGG + Intergenic
1098831110 12:75364186-75364208 CTGAATTACAAAAGGGAGGAAGG + Intronic
1099137501 12:78925621-78925643 CTCTATGAAGAAAGGGAGGATGG - Intronic
1100497731 12:95141611-95141633 CTGTATCATTTTAGGGAGGAGGG - Intronic
1101885792 12:108660559-108660581 CTGTTTGCCTATAGGGAAGAAGG - Intronic
1102511755 12:113420815-113420837 ATGTGTGTCTAAAGCGAGGATGG + Intronic
1102960256 12:117088130-117088152 CTGTATGCCCAAACTGAGGAGGG + Intronic
1104277297 12:127341417-127341439 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1106114695 13:26807106-26807128 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1108248422 13:48540865-48540887 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1113729023 13:112626404-112626426 CTGTGTGACTAGCAGGAGGAGGG - Intergenic
1113842226 13:113366593-113366615 CTGAATTCCTGAAGGGAGGAGGG - Intergenic
1114237904 14:20838174-20838196 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1115655451 14:35439290-35439312 TTGAATGAGGAAAGGGAGGAGGG - Intergenic
1115855160 14:37622655-37622677 CTGCATGGCCAAAGAGAGGAAGG + Intronic
1119163507 14:72472849-72472871 CTGAAAGAGTAAAGAGAGGAAGG - Intronic
1119745459 14:77040644-77040666 CTCACTGACTAGAGGGAGGAGGG - Intergenic
1120622988 14:86789047-86789069 CTGTATTCCAAAAGGGAGGAGGG - Intergenic
1121872176 14:97418575-97418597 CAGTTTGCCTAAATGGAGGAGGG - Intergenic
1124075945 15:26444309-26444331 CTGAATTCCAAAAGGGAGGATGG + Intergenic
1125182500 15:36893745-36893767 CTGCATTAGTAAAGGAAGGAAGG + Intronic
1127726590 15:61756550-61756572 CTTCATGAGTAAAGAGAGGAGGG - Intergenic
1131792964 15:95984644-95984666 CAGTATGACTAAAGTTTGGAAGG + Intergenic
1132375345 15:101325047-101325069 CTGTAGGAGCAAAGGCAGGAGGG + Intronic
1133825971 16:9278569-9278591 CTGGATCATTAAAGGGGGGAAGG - Intergenic
1134042629 16:11080224-11080246 CTAGATGCCTGAAGGGAGGAGGG - Intronic
1135512842 16:23102409-23102431 CTGTATCACAAAAGGAACGATGG + Exonic
1137469575 16:48742622-48742644 CTGTATAAAGAAAGGGAGGCAGG + Intergenic
1139048578 16:63095042-63095064 TTGTATGTCTAAAAGGAGCATGG - Intergenic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1141241168 16:82266599-82266621 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1142442916 16:90112431-90112453 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1142464787 17:128961-128983 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1143322595 17:6077818-6077840 CTGTATAACTGAAGGGAAGAGGG - Intronic
1144018135 17:11216412-11216434 CTGTCTGAGAAATGGGAGGATGG - Intergenic
1144223927 17:13126335-13126357 ATATATGACAAAAGGGAAGATGG - Intergenic
1145223363 17:21107304-21107326 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1146426122 17:32740952-32740974 CTGTGTAAATGAAGGGAGGAAGG - Intronic
1148978559 17:51550727-51550749 CTGAATCACTAAAGGGAGGAAGG + Intergenic
1149013292 17:51880204-51880226 CAGGAGGAATAAAGGGAGGAGGG - Intronic
1149518966 17:57303958-57303980 CTGAATTACTAGAGGGAGGAGGG + Intronic
1151716775 17:75835111-75835133 CTCTATGAATGAAGGAAGGAGGG - Intronic
1152823902 17:82451691-82451713 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1153239186 18:3015253-3015275 CTGAATGATGAAAGGAAGGAAGG - Intergenic
1154498030 18:14976878-14976900 GCGTATGATTAAAGTGAGGAAGG - Intergenic
1155428947 18:25735601-25735623 GTGTGTGACTAAGGGGAGAAGGG + Intergenic
1155514058 18:26606266-26606288 CTGAATTTCAAAAGGGAGGAGGG + Intronic
1156963964 18:43067767-43067789 CTGAATTCCAAAAGGGAGGAAGG + Intronic
1157907003 18:51578067-51578089 CTGAATGACTGCATGGAGGAGGG + Intergenic
1159622166 18:70651107-70651129 CTGTAGGGCTTTAGGGAGGATGG + Intergenic
1163468622 19:17484137-17484159 CTGAATGAATGAAGGAAGGAGGG + Intronic
1167201101 19:48066137-48066159 CTGAATTCCAAAAGGGAGGAGGG + Intronic
925357354 2:3251292-3251314 CTGTGAGGCTAAAGGGAGGGTGG + Intronic
925627051 2:5851985-5852007 CTGAATGACTAAATGTAGGATGG - Intergenic
926190933 2:10727072-10727094 CTGTCTCAAAAAAGGGAGGAAGG - Intronic
927103267 2:19804204-19804226 ATGGATGATTAAAGGAAGGAGGG + Intergenic
928446394 2:31337243-31337265 CTGTATGAATATTGGGGGGATGG - Intronic
931654559 2:64499205-64499227 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
935878756 2:107539919-107539941 CTGTTTCACTAAAAGGGGGATGG + Intergenic
937410883 2:121673958-121673980 CTGTGTCACAAAAGGAAGGAGGG + Intergenic
937631971 2:124111749-124111771 CTGTATGATTAACGTGAAGAAGG - Intronic
938966457 2:136392995-136393017 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
942022494 2:171880712-171880734 ATGGATGACTAGAGGGAGAAAGG - Intronic
942605040 2:177681747-177681769 CTGAATTCCAAAAGGGAGGAAGG - Intronic
942785234 2:179693328-179693350 CTGAATGACTGAAGGGAGAAGGG + Intronic
943079656 2:183242966-183242988 CTGAATGACTAAAGGGAGCACGG + Intergenic
943657250 2:190522611-190522633 CTGAATTCCAAAAGGGAGGAGGG - Intronic
943662360 2:190572534-190572556 CTCTATTACTAAGAGGAGGAAGG + Intergenic
944309589 2:198218541-198218563 CTCTAGGGCTAAAGGGAGGAGGG + Intronic
944691694 2:202164488-202164510 TTGTATGACTCAAGGAAAGAAGG + Intronic
944997280 2:205308255-205308277 CTGTCTTAATAAAGGAAGGAAGG + Intronic
945000229 2:205342117-205342139 CTGTATGACTAAAGGGAGGAAGG + Intronic
946022957 2:216654224-216654246 TTGTCTGACTGAGGGGAGGAGGG + Intronic
946759460 2:222978809-222978831 GTAAATGACTAAAGGGAGGCAGG - Intergenic
1168733542 20:109447-109469 GTGGATTACTAGAGGGAGGAGGG + Intergenic
1168862185 20:1053570-1053592 CTGTCTGGCTGGAGGGAGGAGGG - Intergenic
1169312679 20:4559904-4559926 CTGTAAGACTAAAGGCAAAAGGG + Intergenic
1170823772 20:19776206-19776228 CTGAATTCCCAAAGGGAGGAGGG - Intergenic
1171311970 20:24151878-24151900 CTGTGAGACTCAAGGAAGGAAGG - Intergenic
1171374433 20:24682530-24682552 CTGTAAGACTCAAGGTGGGAGGG - Intergenic
1174839278 20:53886362-53886384 TTGAATTACAAAAGGGAGGAGGG - Intergenic
1174888591 20:54364034-54364056 CTGAATTTCAAAAGGGAGGAGGG - Intergenic
1175495145 20:59409205-59409227 CAGAATGAATCAAGGGAGGAAGG + Intergenic
1176686516 21:9852697-9852719 CTGATTGACCCAAGGGAGGAAGG + Intergenic
1177241307 21:18461719-18461741 CTATATAATTAAAAGGAGGATGG - Intronic
1178451639 21:32707064-32707086 CAGTATGAAAAAAGGGAGAAAGG - Intronic
1178570597 21:33732298-33732320 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1178814461 21:35915296-35915318 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1178897385 21:36570351-36570373 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1179138020 21:38697664-38697686 CTGTATGACTCAGGGAAAGATGG + Intergenic
1180874951 22:19170935-19170957 CTGAAGGAAGAAAGGGAGGAAGG - Intergenic
1181737494 22:24893200-24893222 ATGAATGAATAAAGGAAGGAGGG + Intronic
1182455440 22:30447532-30447554 CTGAATTCCGAAAGGGAGGAGGG + Intergenic
1182750490 22:32637973-32637995 CTGAACTACTAAAGGGAAGAGGG - Intronic
1183551892 22:38492987-38493009 CTTTATTAATAAAGGGAGGGTGG + Intronic
1184892036 22:47386022-47386044 CTGGATGAATAAATGAAGGAAGG - Intergenic
949403329 3:3688436-3688458 CTGTATTCCAAAAGGGAGGAGGG + Intergenic
950352811 3:12373957-12373979 CTGTATGACTAAAAGAGGCAGGG + Intronic
950425957 3:12924860-12924882 CTGAATGCCTACAGGGATGAAGG - Intronic
952688004 3:36171956-36171978 CTGAATTACAAAAAGGAGGAGGG + Intergenic
953422333 3:42764229-42764251 CTGAATTCCAAAAGGGAGGAGGG + Intronic
953491049 3:43351432-43351454 GTGTATGAAGGAAGGGAGGAAGG - Intronic
953765092 3:45734015-45734037 CTGGATGTTTAAGGGGAGGAAGG + Intronic
954203151 3:49037402-49037424 CTGTAAGACAAAAGGGAGGGGGG + Intronic
954923502 3:54212601-54212623 CTGAATTCCAAAAGGGAGGAGGG + Intronic
958989990 3:100831705-100831727 CTGGATGAGTAGAGGGATGAGGG - Intronic
958990881 3:100843430-100843452 CTGTATGACAGAAGAGAGAAGGG + Intronic
959200472 3:103239966-103239988 ATGTATGACTAAAAAGAGGGAGG - Intergenic
961530136 3:127535659-127535681 ATGTTTGACCAAAGGGAGGAAGG - Intergenic
962040910 3:131706616-131706638 CTGAATCCCAAAAGGGAGGAGGG - Intronic
962499681 3:135978048-135978070 CTGTATGATTAAAGGAAGCCAGG + Intronic
963108372 3:141665476-141665498 CTGTAGGAAGAAAGGAAGGAAGG + Intergenic
966141224 3:176758464-176758486 CAGTATGACTAAAGACTGGAGGG + Intergenic
967970693 3:194996930-194996952 CTGAATAAATGAAGGGAGGACGG + Intergenic
968363188 3:198163391-198163413 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
969516464 4:7650942-7650964 CTGCATTTCTCAAGGGAGGATGG - Intronic
970907615 4:21235400-21235422 ATGTTTGACAAAAGGGAAGAAGG - Intronic
973588250 4:52413721-52413743 GTGTGTGACGAAAGGGAGGATGG - Intergenic
973711252 4:53632269-53632291 CTGTGAGAGAAAAGGGAGGATGG - Intronic
977465406 4:97378254-97378276 CTAGATGACAAAAAGGAGGAAGG + Intronic
978423044 4:108554253-108554275 CTGAATTCCAAAAGGGAGGACGG - Intergenic
980639074 4:135550654-135550676 CTGAATAAATAAAGGTAGGATGG - Intergenic
981193679 4:141893063-141893085 CAGGAAGACTAAAGGGAGGAGGG + Intergenic
981398994 4:144289667-144289689 CTGCTTGACTAAAGGAAGAATGG + Intergenic
981958867 4:150511360-150511382 CTATATGACTAAAAGCAGAAGGG - Intronic
982449322 4:155533246-155533268 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
984055267 4:174920691-174920713 CTGGATGAATAAAGGAAAGAAGG + Exonic
984223028 4:177001370-177001392 CTGTAGGAGTAAAAGGAGGGTGG + Intergenic
985240187 4:187922929-187922951 ATGAATGAGTAAAGGAAGGAAGG - Intergenic
985504207 5:269678-269700 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
987542289 5:19271160-19271182 CTGAATTCCAAAAGGGAGGAAGG + Intergenic
987629060 5:20443857-20443879 CTATATGACTAATTGGAAGAAGG + Intronic
988905170 5:35780574-35780596 CTGTCTGACTAAAGGACTGAAGG - Intronic
990319997 5:54620534-54620556 CTGTCTGCCTGAAGGCAGGATGG - Intergenic
991464131 5:66892308-66892330 CAGTAATACAAAAGGGAGGAGGG - Intronic
991747892 5:69765785-69765807 CTATAGGACTAGAGCGAGGAAGG + Intergenic
991749838 5:69789548-69789570 CTATAGGACTAGAGCGAGGAAGG - Intergenic
991799469 5:70345633-70345655 CTATAGGACTAGAGCGAGGAAGG + Intergenic
991801412 5:70369356-70369378 CTATAGGACTAGAGCGAGGAAGG - Intergenic
991827185 5:70640664-70640686 CTATAGGACTAGAGCGAGGAAGG + Intergenic
991829128 5:70664405-70664427 CTATAGGACTAGAGCGAGGAAGG - Intergenic
991891828 5:71345062-71345084 CTATAGGACTAGAGCGAGGAAGG + Intergenic
992583667 5:78209243-78209265 CTGAATTCCAAAAGGGAGGAGGG - Intronic
994162561 5:96572915-96572937 CAGTAAGACAAAAGGAAGGAAGG + Intronic
997792464 5:136772915-136772937 CTGGAGGAGAAAAGGGAGGAGGG + Intergenic
998478234 5:142439522-142439544 ATGTATGAATAAAGGGGAGAGGG + Intergenic
998613430 5:143713916-143713938 CTTTAAAACTAAAGGAAGGAAGG + Intergenic
999684107 5:154087066-154087088 ATGGGTGACTAAAGTGAGGATGG + Intronic
999905371 5:156135428-156135450 CTGTAAGGCTACAGGGAAGAGGG - Intronic
1000763416 5:165254814-165254836 CTGAAATAATAAAGGGAGGAAGG - Intergenic
1001543443 5:172555151-172555173 CTGGATGAATGAATGGAGGAGGG - Intergenic
1003131890 6:3401940-3401962 CTGTCAGACTCATGGGAGGAAGG + Intronic
1004200879 6:13546803-13546825 CTGAATTACAAAAGGGAGGAGGG - Intergenic
1004566427 6:16802257-16802279 CTGGATGAAGAAAGGGACGATGG + Intergenic
1005808987 6:29502135-29502157 TTGCATGACCAAAGGGAGGAGGG + Intergenic
1006865624 6:37206970-37206992 CTGTATGAAGAAAAGTAGGACGG + Intergenic
1006960493 6:37925381-37925403 CTGTAAGACTACAGGAAGGACGG + Intronic
1007331868 6:41117408-41117430 CTTTGTGACTTAAGGGAGGAAGG + Intergenic
1009681761 6:66902675-66902697 CTGTATGACCATAGGCAGCACGG - Intergenic
1015836970 6:137431175-137431197 CTGTCCCACTAAAGGGAGTAAGG - Intergenic
1017841983 6:158229875-158229897 CTGTCAGACTAAAGAGAAGAAGG - Intergenic
1018138986 6:160807745-160807767 CTGAATTACAAAAGGGAAGATGG - Intergenic
1019252492 7:25320-25342 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1019782181 7:2947780-2947802 GTTTATGTCTAAAAGGAGGAGGG - Exonic
1020106788 7:5425909-5425931 CTGTGTGCCTTAGGGGAGGAGGG + Intergenic
1021210187 7:17841243-17841265 CTGTAGGAGTCAAGGGAGAAAGG - Intronic
1022531808 7:31071504-31071526 CTGGAGGACGAAGGGGAGGACGG + Intronic
1024191603 7:47017175-47017197 CTGAATAACAAAAGGGAAGATGG + Intergenic
1024343050 7:48286507-48286529 CTGTCTGAAAAAAGGAAGGAAGG - Intronic
1026606435 7:71819996-71820018 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1031784909 7:126017280-126017302 CTATATGAATAAAGGGAGAGGGG - Intergenic
1032429615 7:131850006-131850028 CTGTAAGACTAAAACAAGGAAGG - Intergenic
1032484266 7:132271998-132272020 ATGTATGATTGAAGGAAGGAGGG + Intronic
1033616041 7:143015089-143015111 CTGTCTGGGAAAAGGGAGGAAGG + Intergenic
1035519425 8:265559-265581 CTGTATGACATGAGGGAGGCTGG + Intergenic
1036192562 8:6683973-6683995 CTGAATGACTAAATGAATGAAGG - Intergenic
1037786481 8:21906295-21906317 CTGGATCACTAAAGGCTGGAAGG - Intergenic
1038129897 8:24718136-24718158 CTATATTTTTAAAGGGAGGAGGG + Intergenic
1038739506 8:30204578-30204600 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1039385940 8:37135629-37135651 CTGGATGACTAAGAGGAGAAAGG + Intergenic
1039722202 8:40176245-40176267 CTGAATTCCAAAAGGGAGGAAGG - Intergenic
1042742707 8:72068563-72068585 TTTAATGACTAAAAGGAGGAAGG - Intronic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1044727582 8:95205760-95205782 CTGTATAAGGATAGGGAGGATGG + Intergenic
1045311877 8:101010068-101010090 CTGTACTGCTAAAGGGAGTAGGG + Intergenic
1045533523 8:103006085-103006107 CTGAATTCCAAAAGGGAGGATGG + Intergenic
1046378281 8:113416926-113416948 CTGTATGAATACTGTGAGGAAGG + Intronic
1046990453 8:120446779-120446801 CTGTATAACTAAGGGGAGTGTGG + Intronic
1047187209 8:122644703-122644725 CTGGATGGCTAAAGGGACAATGG + Intergenic
1047253421 8:123197687-123197709 TTGCATCACTAAAGGGAAGAAGG + Intronic
1048169479 8:132092192-132092214 CTGTCTTACTAAAGGAAGGTGGG - Intronic
1050243582 9:3663131-3663153 CTCTATGACTAAAAGGAAAAGGG + Intergenic
1052462367 9:28782342-28782364 GTGAATGAATGAAGGGAGGAAGG - Intergenic
1053130767 9:35614039-35614061 CTGTATGGCCAAATGGAAGAGGG + Intronic
1054997024 9:71403467-71403489 CTGTATGACTCAAGGGTGTTAGG + Intronic
1055449526 9:76418378-76418400 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1056995344 9:91452116-91452138 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1058125494 9:101189464-101189486 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1059408152 9:114115180-114115202 CTGAATCCCAAAAGGGAGGAGGG + Intergenic
1059533630 9:115060839-115060861 CTTTATGTCTAAAGGAAGAATGG + Intronic
1062747875 9:138227051-138227073 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1187071099 X:15889223-15889245 CTGTAAGAACAAATGGAGGAGGG + Intergenic
1188876209 X:35433555-35433577 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1189444819 X:41070776-41070798 CTGAATGACTGCATGGAGGAAGG - Intergenic
1189758752 X:44299286-44299308 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1193674751 X:84436574-84436596 CTGAATGACTAACGGGTGAAAGG - Intronic
1193959208 X:87902625-87902647 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1196968443 X:121083728-121083750 CTGGTTCACTAAAGGGAGCAGGG - Intergenic
1196989673 X:121314325-121314347 CTGTAAGATTTAGGGGAGGATGG + Intergenic
1197351370 X:125387551-125387573 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1197730210 X:129803543-129803565 CTTTATGGGTAAAGGCAGGATGG + Exonic
1200444904 Y:3248642-3248664 CTGAATTCCAAAAGGGAGGAGGG - Intergenic