ID: 945005583

View in Genome Browser
Species Human (GRCh38)
Location 2:205401827-205401849
Sequence CTTCACAACTAAATGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945005580_945005583 -7 Left 945005580 2:205401811-205401833 CCTGAAAATTCTTTGCCTTCACA 0: 1
1: 0
2: 2
3: 30
4: 269
Right 945005583 2:205401827-205401849 CTTCACAACTAAATGGAGCTTGG 0: 1
1: 0
2: 0
3: 9
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945005583 Original CRISPR CTTCACAACTAAATGGAGCT TGG Intronic
900952491 1:5865736-5865758 CTTCACAGTCAAATGGGGCTGGG + Intronic
906315387 1:44783907-44783929 CTTCACAGCAACAGGGAGCTAGG - Exonic
907135151 1:52133455-52133477 ATTCTCTACTAAATGGAACTTGG + Intergenic
907632275 1:56094774-56094796 CTTCAGAAATTAATGGAGATGGG + Intergenic
908265473 1:62374699-62374721 ATTCTCCACTAAAAGGAGCTAGG + Intergenic
909031463 1:70545929-70545951 CTTCACAAATAAATTTTGCTTGG - Intergenic
909711657 1:78657551-78657573 TTTAACAAATAAATGGATCTAGG - Intronic
910274490 1:85434273-85434295 CATCACAAGTCAATGGGGCTAGG - Intronic
913006558 1:114638461-114638483 CTTAAAAATTAAATGGAGCTGGG + Intronic
917171645 1:172183036-172183058 CTTTTTAACTAAAGGGAGCTAGG + Intronic
919889633 1:201961538-201961560 ATTCTCAACTAAAAGGAACTGGG - Intronic
920460985 1:206140184-206140206 CTTCACAGCCAAATGGACCGAGG + Intergenic
920518833 1:206607736-206607758 CATGACAACTAAATGGAATTTGG + Intronic
921728438 1:218550232-218550254 CTTCAGAACTTAGTGGAGCCTGG - Intergenic
924018701 1:239757214-239757236 ATTAACAACTAAATGAAGTTTGG - Intronic
1070666197 10:78345880-78345902 CCTTTCAACAAAATGGAGCTGGG - Intergenic
1073277835 10:102328085-102328107 CGTCAAAAATAGATGGAGCTAGG - Intronic
1073672140 10:105603687-105603709 CCTCTTAAATAAATGGAGCTGGG + Intergenic
1074601617 10:114919694-114919716 CTCAACAACTATATGGAGATGGG - Intergenic
1074653893 10:115559618-115559640 ATTCACCAATAAAAGGAGCTTGG + Intronic
1082932853 11:58626921-58626943 TTTCAGAACTCAGTGGAGCTTGG + Intergenic
1089244487 11:117109059-117109081 CTTAAAAACTAAATGGGGCCAGG - Intergenic
1089894165 11:121911176-121911198 CTTAACAACTAAATGATGTTAGG - Intergenic
1097083496 12:56450473-56450495 CTTCCAACCTAAATAGAGCTTGG - Exonic
1103040257 12:117689215-117689237 CTTCACAAATCAATGTATCTTGG + Intronic
1103937673 12:124485075-124485097 CTTCACCATTACATGGGGCTTGG + Intronic
1105042610 12:132972227-132972249 TCTCACAAATAAATGGAGTTCGG - Intergenic
1106828453 13:33551248-33551270 CTTCACAGCTGAAGGGGGCTGGG + Intergenic
1107567037 13:41615253-41615275 CTTCCCAACTAGATGGATGTTGG - Intronic
1107631175 13:42344138-42344160 CTCCAAAACTCAATGGACCTGGG - Intergenic
1118377476 14:65189845-65189867 CTTCCCAACTAAATGCCACTGGG + Intergenic
1120148161 14:81002441-81002463 CTTCACAACAACATTGAGATAGG - Intronic
1120630845 14:86888184-86888206 CTTTACAACAAAATGGTGCTGGG + Intergenic
1121101980 14:91255513-91255535 CTTCACAACTACATTCAGTTTGG - Intergenic
1125919129 15:43514675-43514697 CTTGACCACTAGAAGGAGCTGGG - Intronic
1126409654 15:48359536-48359558 TTTCAGAACTAAATAGACCTAGG - Intergenic
1126920505 15:53517124-53517146 ATTGATAACTAAATGGAACTGGG + Exonic
1130668239 15:85887678-85887700 CCACCCAACTAAATGGAGCATGG - Intergenic
1131368046 15:91855985-91856007 TTTGACAAATAAATGAAGCTGGG + Intronic
1131658692 15:94490183-94490205 CTTCTCCAATAAATGGTGCTGGG + Intergenic
1131689220 15:94808535-94808557 CATGACAACTAAATGTAACTTGG + Intergenic
1131950593 15:97677376-97677398 CCTCACACCTAAATGTAGTTTGG - Intergenic
1135547604 16:23376557-23376579 GCTCACAACCAATTGGAGCTGGG + Intronic
1143341843 17:6217422-6217444 CTTTATAACTAAATGCATCTTGG + Intergenic
1145850377 17:28088319-28088341 CTTAACAAATTAATGGATCTAGG - Intronic
1148151823 17:45401457-45401479 CTCTAGAACTGAATGGAGCTTGG + Intronic
1148435887 17:47684739-47684761 CTCCACCACTGAATGGATCTGGG - Exonic
1149222716 17:54434230-54434252 CTTCAAAACTAAGTGAACCTGGG - Intergenic
1150665419 17:67131376-67131398 CTTCACAAAAAGCTGGAGCTTGG + Intronic
1151229077 17:72669344-72669366 CATCACAACTAAATGCAACATGG - Intronic
1151498040 17:74471155-74471177 CTTAATAAGTAAATGGAGCCTGG - Intronic
1153482306 18:5559267-5559289 CTTTACAAATAAATGGAGGAGGG + Intronic
1153668581 18:7388658-7388680 CATCAAAACTAATTTGAGCTTGG + Intergenic
1155172947 18:23280671-23280693 CTTCACCACAAAATGGAACCCGG + Intronic
1155776774 18:29774108-29774130 CTTCACATTTCAAAGGAGCTAGG - Intergenic
1158765830 18:60448482-60448504 CTACACAACTAATTGTATCTTGG - Intergenic
1159332902 18:67024090-67024112 CTTCACTATGAAATGGAACTTGG + Intergenic
1164082374 19:21869968-21869990 GTACAGAACTAAATGAAGCTAGG + Intergenic
1165507605 19:36244193-36244215 CCTCACCACAAAGTGGAGCTAGG + Intronic
1166322921 19:42030146-42030168 CTATTCAAGTAAATGGAGCTGGG + Intronic
1166350551 19:42196061-42196083 TTTCACAACTAAACGTATCTGGG + Intronic
927964434 2:27260402-27260424 CTTGACAAATGAATGGGGCTTGG + Intronic
929388246 2:41437236-41437258 CTTCAATAATAAATGGTGCTTGG - Intergenic
930714245 2:54577709-54577731 CTTAACTAGTAAATGGAGCCAGG + Intronic
931279961 2:60781725-60781747 CTTCAGAAATAAATGCAGTTGGG + Intronic
940990805 2:160094405-160094427 CTTCAAAAATAAATGGTGCTGGG + Intergenic
941096475 2:161244051-161244073 CTTCACTAGGAAATGGAGCCGGG - Intergenic
941742468 2:169049622-169049644 CTTTCCAACAAAATGGTGCTGGG + Intergenic
944005434 2:194898848-194898870 CTTCACCAGAAATTGGAGCTTGG - Intergenic
945005583 2:205401827-205401849 CTTCACAACTAAATGGAGCTTGG + Intronic
945108447 2:206339874-206339896 CTTTTCAACTAAATGCTGCTGGG - Intergenic
946576025 2:221076615-221076637 ATTCACAACAAAATGGAGACAGG - Intergenic
947803349 2:232946643-232946665 ATTCTCCACTAAATGGAGCTAGG + Intronic
1169055909 20:2620833-2620855 CTTTAAAACTTAATGGAGCTTGG + Intronic
1173648749 20:44650159-44650181 CTTCACGTCTTACTGGAGCTGGG - Intronic
1176203149 20:63873128-63873150 CCCCACAACTAAATGGTTCTGGG - Intronic
1178708653 21:34895176-34895198 CTTCTCAGCCAAATGGACCTTGG - Intronic
949650682 3:6155565-6155587 CTTTAGAGCTAAAGGGAGCTTGG - Intergenic
950123726 3:10498724-10498746 CTTCAAAGCTACATGGTGCTTGG + Intronic
952077844 3:29719873-29719895 CTTCCCACCTAATTGGAACTCGG + Intronic
952275020 3:31868401-31868423 CTTCAAAACCCGATGGAGCTCGG - Intronic
954976664 3:54702019-54702041 ATTCAAAAATAAATGGTGCTGGG + Intronic
956526554 3:70169382-70169404 CTTCAAAACTTTATGGATCTAGG + Intergenic
961982174 3:131091823-131091845 CTTCAGAACTAGAAGGAGTTCGG + Intronic
963161166 3:142151653-142151675 ATTCACAACTAAATCAAACTAGG - Intergenic
967366753 3:188695606-188695628 CTTCACCTGTAAATGGAGTTGGG - Intronic
969635442 4:8366557-8366579 CTTCTCAATGAAGTGGAGCTCGG + Exonic
970065269 4:12086467-12086489 CATCACTGCTAAATGGAGATCGG + Intergenic
970590131 4:17552820-17552842 TTTAAAAACTAAATGGGGCTGGG + Intergenic
972153528 4:36126901-36126923 CATCACAACTCACTGAAGCTTGG + Intronic
973911015 4:55580390-55580412 CTTCACAACTAAAATAAGTTGGG - Intronic
974180937 4:58383910-58383932 CTTCAAAAATAAATGAATCTGGG - Intergenic
975022514 4:69506617-69506639 ATTCACAGCTAAATGGTGCCAGG + Intronic
979072614 4:116228350-116228372 CTACACAACTAAATGGAATCAGG + Intergenic
983433361 4:167679672-167679694 GTACACAACTCAGTGGAGCTAGG + Intergenic
983864575 4:172749437-172749459 CTTCACACATAAATGGAGAGAGG - Intronic
984575332 4:181441277-181441299 CTCCACAACAACTTGGAGCTGGG + Intergenic
987694891 5:21315513-21315535 AACCACAACAAAATGGAGCTCGG + Intergenic
988332029 5:29854102-29854124 CTTCATAATTAAATGTATCTTGG - Intergenic
988708909 5:33754120-33754142 CTTCTCATCTAACTGGAGCCAGG + Intronic
988930874 5:36034584-36034606 CTTCTCATCCACATGGAGCTGGG + Intergenic
988934694 5:36070405-36070427 CTTCTCATCTACATGGATCTGGG + Intronic
989240346 5:39196068-39196090 GTACTCAACTGAATGGAGCTTGG - Intronic
991745338 5:69733928-69733950 AACCACAACAAAATGGAGCTGGG - Intergenic
991752369 5:69821298-69821320 AACCACAACAAAATGGAGCTGGG + Intergenic
991796906 5:70313657-70313679 AACCACAACAAAATGGAGCTGGG - Intergenic
991824715 5:70609242-70609264 AACCACAACAAAATGGAGCTGGG - Intergenic
991831687 5:70696422-70696444 AACCACAACAAAATGGAGCTGGG + Intergenic
991889284 5:71313213-71313235 AACCACAACAAAATGGAGCTGGG - Intergenic
992319400 5:75596430-75596452 CTTCACATTTAAATGTATCTTGG - Exonic
992849619 5:80793856-80793878 TGTCAAAGCTAAATGGAGCTGGG + Intronic
993614269 5:90091609-90091631 CATGACAACTAAATGCAGTTTGG + Intergenic
996296840 5:121928887-121928909 CCTCACAAGTAACTGGAACTTGG - Intergenic
996377136 5:122822948-122822970 CTTCAGAACTCCATGAAGCTGGG + Intronic
998876306 5:146603513-146603535 CTCCACAAATAAATGGTGGTAGG - Intronic
1000022853 5:157333561-157333583 TTTCCCATCTGAATGGAGCTGGG + Intronic
1000829426 5:166084682-166084704 CTTCTCAGGTAAATGAAGCTAGG + Intergenic
1002078708 5:176725254-176725276 CTTAAAAGGTAAATGGAGCTGGG - Intergenic
1003053515 6:2800011-2800033 ATACATAAGTAAATGGAGCTGGG + Intergenic
1003267437 6:4578362-4578384 TTTCTCCACTAAATGGAGCTAGG + Intergenic
1003733269 6:8849971-8849993 CTTCTCAACTCAGTAGAGCTGGG - Intergenic
1004277051 6:14246117-14246139 CTGCAAAACTAAAAGGATCTGGG - Intergenic
1004411052 6:15381986-15382008 TTTAACAACCAAATGGGGCTGGG + Intronic
1004839553 6:19567477-19567499 TTTCACAAGAAAATAGAGCTGGG + Intergenic
1005067911 6:21836543-21836565 TTTCACCACAAAATGAAGCTTGG + Intergenic
1005556006 6:26984417-26984439 AACCACAACAAAATGGAGCTGGG - Intergenic
1006241975 6:32690146-32690168 CTTCACTACTGACTGGATCTTGG - Intergenic
1006799899 6:36753096-36753118 CTTCAAAACAAAAGGGAGCTTGG + Intronic
1008820030 6:55620855-55620877 CTTCATCAATAAATGGTGCTGGG - Intergenic
1011087607 6:83559969-83559991 CTTCAGAAGTAAAGGGAGCTTGG - Intronic
1011502244 6:88003665-88003687 CTTCCCATCTCAATGGAGCATGG + Intergenic
1013351327 6:109308649-109308671 CTTCAAAACAATATGGAGGTGGG + Intergenic
1016076051 6:139796972-139796994 CTTCTCAACTAGATAGAGTTTGG + Intergenic
1017641065 6:156494449-156494471 CTCCCCAACCCAATGGAGCTAGG + Intergenic
1027910851 7:84248411-84248433 CTTCACAGCAAAAGGGAACTGGG + Intronic
1030774878 7:113522266-113522288 CTTCATACCTAAATTGAGATAGG - Intergenic
1031178267 7:118380089-118380111 CTTAACAACTAAAATGAGATTGG - Intergenic
1038226747 8:25664589-25664611 CCTCACTACTAAATGGTGATAGG - Intergenic
1038444084 8:27591274-27591296 CTTCACAACAACACGGAGATGGG - Intergenic
1038910140 8:31954232-31954254 CTTCACCTCTAAATGGGGGTTGG - Intronic
1038950503 8:32409161-32409183 CTTATCAAATAAATGGTGCTAGG + Intronic
1043291876 8:78612217-78612239 GTTCAGAACTGAATGGAGATGGG - Intergenic
1044145925 8:88713717-88713739 CTTCATCACTAAATAGAGGTTGG - Intergenic
1044361372 8:91288570-91288592 CTTCCCAACTAATGGGACCTTGG - Intronic
1046156486 8:110297000-110297022 CTTCAGAACTAAATAGGCCTGGG + Intergenic
1046787790 8:118286604-118286626 CTTCCCAGCTAAAGGGAGCATGG - Intronic
1051696857 9:19777075-19777097 TTCCACACCTAAATGGAGCCAGG - Intronic
1052030980 9:23628631-23628653 CATCTCAAATACATGGAGCTTGG + Intergenic
1058880173 9:109278839-109278861 CTTCCCAACAAAATCTAGCTTGG - Intronic
1058954573 9:109933627-109933649 CTTCAAAGATAAAGGGAGCTGGG - Intronic
1062608014 9:137356908-137356930 CTTCACCACTACCTGGAGGTCGG - Intronic
1193039589 X:76990520-76990542 CTTCAAAAATCAATGGATCTAGG + Intergenic
1193157340 X:78188365-78188387 CTTTTCAACCAAATGGTGCTGGG + Intergenic
1195671124 X:107470954-107470976 CTACACAACAAACTTGAGCTTGG - Intergenic
1196373582 X:115005394-115005416 CTTCAGAACTGAGTTGAGCTTGG + Intronic
1196682361 X:118482196-118482218 CTTCCCCACCAAATGGTGCTGGG - Intergenic
1197555723 X:127950259-127950281 CTTCACATATAAATGAAGCTGGG + Intergenic