ID: 945005949

View in Genome Browser
Species Human (GRCh38)
Location 2:205406467-205406489
Sequence TTAGTTCATCACATAAATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 309}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945005949 Original CRISPR TTAGTTCATCACATAAATAT TGG Intronic
904331833 1:29763746-29763768 TCAATTCATTTCATAAATATAGG - Intergenic
904795555 1:33053736-33053758 ATAGTTAATCGCATAAATACAGG - Intronic
906228955 1:44144015-44144037 TTACTACATCCCATAAATTTTGG - Intergenic
906811883 1:48835405-48835427 TTAAATAATCACACAAATATGGG + Intronic
908055404 1:60280861-60280883 TTTCTTCATCAGATAAATAAAGG - Intergenic
908334407 1:63106000-63106022 TGAGTTCAGCAAATGAATATGGG + Intergenic
908587853 1:65592844-65592866 TCAGTTCAGCCCATAAATATGGG + Exonic
909754863 1:79212594-79212616 ATAATTCATCACATACATATTGG + Intergenic
911241842 1:95476216-95476238 TTAGTTCATCATCTAATTAGAGG + Intergenic
911445392 1:97985704-97985726 TTAGTTCATTTCATAAAAAAAGG + Intergenic
912200991 1:107457539-107457561 TTAGAGCATTACATGAATATTGG - Intronic
912446754 1:109742202-109742224 TTAGTTCTTCCCATGACTATAGG - Intronic
913438872 1:118876251-118876273 ATATTTCATCACACTAATATTGG - Intergenic
916277475 1:163010395-163010417 TTACTTCCTAACAAAAATATTGG + Intergenic
918009050 1:180569509-180569531 TAATTTCATCCCATTAATATTGG + Intergenic
918870405 1:189965883-189965905 TTATTTGATCATATAAATATAGG + Intergenic
918975859 1:191485142-191485164 TTAATGCATTACATAAATTTTGG - Intergenic
919995742 1:202748098-202748120 TCAATTCACCACATAAGTATGGG - Intronic
921824476 1:219656883-219656905 TCAGTTCATCCCCTCAATATTGG + Intergenic
921903152 1:220469057-220469079 TTAATTTTTCACATAAATACTGG - Intergenic
1063066688 10:2617125-2617147 TTAATTCTTCACCTAGATATGGG + Intergenic
1063215219 10:3918981-3919003 TTAGTTGACCACATATATTTAGG + Intergenic
1063736479 10:8761235-8761257 TTTGTTCTCCACATAAGTATAGG + Intergenic
1065103029 10:22350632-22350654 TTAGTTAGTCAAATAAGTATAGG - Intronic
1065868705 10:29936599-29936621 TTATTTCTTTACATAAAGATAGG - Intergenic
1066138704 10:32480533-32480555 TTGCTGCATCACATAAATTTTGG + Intronic
1067257382 10:44655952-44655974 TATTTTCATCCCATAAATATTGG + Intergenic
1068271754 10:54736768-54736790 ATAGTTCCTAACAAAAATATGGG - Intronic
1068806314 10:61197793-61197815 TTATTTTTTCACATAAAAATGGG + Intergenic
1068992095 10:63160783-63160805 ATAGATCATTACATAAAAATTGG - Intergenic
1069073199 10:64011329-64011351 TTAACTCAACACATAAAGATAGG - Intergenic
1069281017 10:66653795-66653817 TTAGTTGATCATATATACATGGG - Intronic
1069503156 10:68972484-68972506 ATAGTTCTTCACGTAAATAAAGG + Intronic
1069654535 10:70078022-70078044 TATTTTCATCACACAAATATTGG - Intronic
1071172285 10:82880433-82880455 TTATTTCTTCACATATATAGTGG - Intronic
1074745890 10:116531956-116531978 TAAGTTCATAACCTAAATAGTGG + Intergenic
1075044675 10:119137368-119137390 TTAGTTTATCACATAAGGACTGG - Intronic
1075212547 10:120503258-120503280 TTAGTTCCTCAGGTAAAGATTGG + Intronic
1075799403 10:125143561-125143583 TTAGTAAATCAAATAAAAATAGG - Intronic
1077763836 11:5135323-5135345 TTAATTTATCACATAGGTATAGG + Intergenic
1078278338 11:9873285-9873307 TTAGTACAGCATAAAAATATTGG + Intronic
1078942164 11:16019545-16019567 TTAGTTCATAACACAGATTTAGG - Intronic
1078953954 11:16168398-16168420 TTAATTCATGTCATAAATAAGGG + Intronic
1079381134 11:19938535-19938557 TTAGTTCAACATTTAAAAATCGG - Intronic
1079748944 11:24170488-24170510 TTAGTAAAACACATAGATATTGG + Intergenic
1080479806 11:32635401-32635423 TCAGTTGATCAAATATATATGGG - Intronic
1081834053 11:46139147-46139169 TCAGTTTATCTCATACATATTGG - Intergenic
1082185800 11:49179579-49179601 TTGCTGCATCTCATAAATATTGG - Intronic
1082210496 11:49495800-49495822 TTAGTTCAACATATTAATTTGGG + Intergenic
1086218162 11:84408017-84408039 CTAGTTCTTCACATACATCTAGG - Intronic
1086423477 11:86660856-86660878 TTATTTCATCATACAAATTTTGG - Intronic
1086552185 11:88065485-88065507 TTAGTGCATCCCCTAGATATAGG + Intergenic
1086680525 11:89665796-89665818 TTGCTGCATCTCATAAATATTGG + Intergenic
1087242733 11:95797797-95797819 TTAGTTAATCACATAGTTAATGG + Intronic
1087530468 11:99374789-99374811 TTAGATCATCATGTAAATATTGG + Intronic
1087875552 11:103351607-103351629 ATATTTCATCACATAAATTAAGG - Intronic
1089022558 11:115231675-115231697 TTATTTTATAACATAAATTTAGG - Intronic
1089281604 11:117378793-117378815 TCAGTTTCTCACAGAAATATAGG + Intronic
1090310127 11:125729186-125729208 TTAGTTCATTACTTATACATGGG - Intergenic
1090869818 11:130734119-130734141 TTAGTTCATATGATAGATATTGG + Intergenic
1090996934 11:131875122-131875144 TTATTTCATCACATATAGAATGG + Intronic
1092397722 12:8143240-8143262 GTATTTCAACACATAAACATGGG - Intronic
1092642457 12:10530013-10530035 TTAGTCCATAACATATTTATAGG + Intergenic
1093771078 12:23019439-23019461 TTAGTTCATCACTTATATAGAGG - Intergenic
1093955672 12:25215407-25215429 TAAGTTCAGCACATTAATTTTGG - Intronic
1094274265 12:28653459-28653481 TTGATTCATCTCATAAATTTTGG + Intergenic
1097538678 12:60907469-60907491 AAAATTCATCACATAAATAGGGG + Intergenic
1099808656 12:87552491-87552513 TTATTTAATCAAATAACTATTGG + Intergenic
1099941067 12:89188797-89188819 TTACTACATCCCATAAATTTTGG - Intergenic
1100046665 12:90390442-90390464 ATTCTTAATCACATAAATATGGG + Intergenic
1101145737 12:101839006-101839028 TTATTGCATCCCATCAATATTGG + Intergenic
1102650074 12:114435412-114435434 TTAGCTCCTCTCATAAATAAAGG + Intergenic
1103861377 12:124017202-124017224 TAAGTACCACACATAAATATAGG + Intronic
1105376438 13:19849422-19849444 TTATGTCATCATAAAAATATAGG - Intronic
1105485388 13:20825061-20825083 TTTGCTCATCACATAAATATTGG - Intronic
1105602480 13:21899681-21899703 TGACTTCATCAATTAAATATAGG + Intergenic
1105866692 13:24467270-24467292 TTACTTCCACACTTAAATATTGG + Intronic
1109342816 13:61083526-61083548 TTATTTAATAACATCAATATTGG + Intergenic
1109781975 13:67123167-67123189 TCAGTTAATAACATAAAGATGGG - Intronic
1109956629 13:69576438-69576460 TTGCTTCATCCCATAAATTTTGG - Intergenic
1110121160 13:71883400-71883422 TTAGGTAAGCAAATAAATATTGG - Intergenic
1111260106 13:85726291-85726313 TTAATTCTTGCCATAAATATTGG - Intergenic
1111318580 13:86593758-86593780 TTCTTTCATGACATAAATTTTGG - Intergenic
1111435208 13:88197610-88197632 GTAATTCATCACATAAGTAGAGG + Intergenic
1111493386 13:89015543-89015565 TTAATTCTTTATATAAATATTGG + Intergenic
1111507028 13:89204930-89204952 TGAGGTCATCACAGAAATGTTGG - Intergenic
1114276010 14:21145598-21145620 ATGGTTCACCACATAAAAATTGG - Intergenic
1115018367 14:28644378-28644400 TAAGTTTATGAAATAAATATTGG + Intergenic
1116071788 14:40056326-40056348 TGAGGACATCAAATAAATATGGG + Intergenic
1116398941 14:44481465-44481487 TTAGTTCATTAGAAAACTATGGG - Intergenic
1116629842 14:47316442-47316464 TCAGTTCATCAAATAAATGAAGG + Intronic
1116890717 14:50265573-50265595 TTATGTCATCACAAAAATCTAGG + Intronic
1117638061 14:57768248-57768270 TCAGTTTATCCAATAAATATGGG + Intronic
1121246793 14:92466618-92466640 TCAGTGCTTCACATAAACATAGG + Intronic
1122095622 14:99368999-99369021 TCAGTTCACCACAGAAACATGGG + Intergenic
1123897774 15:24845692-24845714 TTAGTTTCTTACATAAATTTTGG + Intronic
1125188366 15:36959470-36959492 TTAGTTCAACACGTATTTATTGG - Intronic
1125446497 15:39763396-39763418 TTGGCTCATCTCAAAAATATAGG + Intronic
1126659025 15:51013144-51013166 TAATTTTATCACATACATATGGG + Intergenic
1126712628 15:51477137-51477159 TTAGTTCATAACTTTAATTTAGG - Intronic
1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG + Intronic
1128841804 15:70856450-70856472 TTAAGTCATAGCATAAATATGGG + Intronic
1130629163 15:85548262-85548284 TTTCTTCATCTCATAAATAAAGG + Intronic
1133798006 16:9062286-9062308 TTAGTTCATCCTTTAAATAAAGG + Intergenic
1135701417 16:24635972-24635994 TTAATTCATTACATATTTATTGG + Intergenic
1135863871 16:26082412-26082434 TTAGATCATCACATATTTAAGGG + Intronic
1136933889 16:34441219-34441241 TTAATTTATGACATAACTATTGG - Intergenic
1136970683 16:34970595-34970617 TTAATTTATGACATAACTATTGG + Intergenic
1137657058 16:50169221-50169243 TTTCTTCAACAAATAAATATGGG - Intronic
1138905764 16:61330457-61330479 GAAATTCATCACATAAATAATGG + Intergenic
1139159966 16:64492985-64493007 TTAGTTCATAATATGATTATAGG - Intergenic
1139168343 16:64598401-64598423 TTCATTCAACACATATATATTGG + Intergenic
1141410056 16:83827060-83827082 TTCATTCAACAAATAAATATTGG - Intergenic
1142374427 16:89699868-89699890 TTAGTTCTTCACCTAAGTGTAGG - Intronic
1146104136 17:30015468-30015490 TTTGATCTTCAAATAAATATGGG - Intronic
1146672661 17:34752484-34752506 TTAGGTCAATACATAAATTTGGG + Intergenic
1149121601 17:53173641-53173663 TAGGTTCATCATATAAATAATGG - Intergenic
1149897769 17:60442718-60442740 TTATTTCCTCACATGAATAAGGG - Intergenic
1150564766 17:66329029-66329051 TTAGTTCTTCACATAACAGTAGG - Intronic
1151063590 17:71125151-71125173 TTATTTGATCATAAAAATATTGG - Intergenic
1153874521 18:9356623-9356645 TTAGTTAATAATATAAATACAGG + Intronic
1153923738 18:9814237-9814259 TTAATTTAGCAGATAAATATGGG - Intronic
1155459156 18:26057060-26057082 TTATAGCATAACATAAATATTGG - Intronic
1156590234 18:38479848-38479870 TTATTTGATCAAGTAAATATGGG - Intergenic
1159132675 18:64297813-64297835 TCAGTTCACCATATAAATGTGGG - Intergenic
1159301511 18:66577420-66577442 TCAATTGATCACATAAATGTAGG - Intronic
1159707169 18:71706150-71706172 TGAGTTCAACCCATAAATAAAGG - Intergenic
1159899794 18:74035453-74035475 TTGGTTCTTCATCTAAATATTGG + Intergenic
1160311539 18:77796091-77796113 ATAATTCATCATATAAAAATGGG - Intergenic
1164446844 19:28325011-28325033 TTAGTTCATCCCAGAAAGGTGGG - Intergenic
925432051 2:3802999-3803021 TTAGGTCAATACATGAATATAGG - Intronic
925794491 2:7527579-7527601 TGAGTTGCTCACATCAATATGGG + Intergenic
927462856 2:23313913-23313935 CTACTTCATCACACCAATATCGG + Intergenic
928117332 2:28555682-28555704 TTAGTTCAGCAAATATTTATTGG - Intronic
928219264 2:29389823-29389845 ATAGCTCATCACATAACTCTTGG + Intronic
928276600 2:29906390-29906412 TTAATTCAACAAATAATTATTGG - Intronic
929390753 2:41465890-41465912 TTATTTCCTCATATACATATAGG - Intergenic
929554629 2:42918068-42918090 TCAATTCAACACATAATTATGGG + Intergenic
929578759 2:43068870-43068892 TTCATTCATCACATAATTGTTGG - Intergenic
930738628 2:54805947-54805969 TGAGTTGATCATATAAATGTGGG + Intronic
930748525 2:54909266-54909288 TTAGTTCATCGGAAAAGTATTGG + Intronic
931277035 2:60753183-60753205 ACAGATCATCACATACATATTGG + Intergenic
931821021 2:65952517-65952539 TTAGTTCAAGAAATAAAAATGGG + Intergenic
932944743 2:76214627-76214649 TTACCTCATGTCATAAATATAGG - Intergenic
933092912 2:78144290-78144312 TGATTTCAACACATAAATTTAGG + Intergenic
934235057 2:90223782-90223804 ACATTTCATCAGATAAATATAGG - Intergenic
934885085 2:98017314-98017336 ATAGTTAATCAGATAAATGTGGG + Intergenic
936283661 2:111164047-111164069 TTGGTTGTTCACTTAAATATGGG + Intronic
936772282 2:115928406-115928428 TTAGTTGATTACATTTATATGGG + Intergenic
936798804 2:116241413-116241435 TTAGTTGATCATCAAAATATGGG - Intergenic
937618776 2:123960805-123960827 GTATTTCATAACATAAATAGTGG + Intergenic
937699601 2:124849273-124849295 TTAGTTGATCACAAATGTATAGG + Intronic
938769516 2:134489212-134489234 ATTGTTCATCATATAAATGTAGG - Intronic
938840397 2:135156291-135156313 TTATTTCAACACATAATAATTGG + Intronic
939043303 2:137218791-137218813 TAAGATCTTCACATGAATATTGG - Intronic
939214651 2:139220263-139220285 TTATTTCATCACTTAAACAATGG + Intergenic
939412190 2:141842466-141842488 TTGGTTCCTCACCTAAAAATGGG + Intronic
940010240 2:149046270-149046292 TTATTTTATAACCTAAATATAGG - Intronic
940136734 2:150445580-150445602 TTAGATCAGCAAATAAATAAAGG - Intergenic
941229251 2:162889064-162889086 TTACATAATCATATAAATATGGG - Intergenic
942145140 2:173019346-173019368 TTCGTTCATCACATATTTACTGG + Intronic
942415493 2:175754456-175754478 TTATTTCATCACCTCAACATGGG + Intergenic
942606414 2:177696258-177696280 ACAGGTCATAACATAAATATAGG + Intronic
942818954 2:180087899-180087921 TCAGTTGAGCATATAAATATGGG + Intergenic
943217488 2:185057585-185057607 TTAGTTCAATACACAAAAATAGG + Intergenic
944230198 2:197384792-197384814 TTTGTTCAATACATACATATTGG + Intergenic
944850739 2:203716475-203716497 TTTATTCATCAAATAAATAAGGG - Intronic
945005949 2:205406467-205406489 TTAGTTCATCACATAAATATTGG + Intronic
945370997 2:209017585-209017607 TTAGTTTAGTACATAAATGTTGG + Intergenic
945650969 2:212558865-212558887 TTTGTTCACCTCTTAAATATTGG - Intergenic
945760647 2:213909895-213909917 TTATTTCAACTCATAAAGATTGG + Intronic
946123306 2:217536120-217536142 TTATTTCCTCACATCATTATGGG - Intronic
946956537 2:224936172-224936194 TTAGTACATGCCATAAATAATGG + Intronic
1169602592 20:7278607-7278629 AGAGTTCATCACATTAATTTGGG + Intergenic
1169904656 20:10590103-10590125 TTTGTTAAACAAATAAATATGGG + Intronic
1170777252 20:19387487-19387509 TTACTGCATCACATAATTTTTGG + Intronic
1173259761 20:41423244-41423266 TTAAAACATCACAGAAATATTGG - Intronic
1176151178 20:63591791-63591813 TTGGTTCATCACAGAAATGCCGG + Intronic
1178809876 21:35871897-35871919 CTAGTTCATGCAATAAATATTGG - Intronic
1178885500 21:36481840-36481862 TTCGTTCATCAAATAGTTATTGG + Intronic
1180939659 22:19650385-19650407 TTAGTGCATCCCATAAGTTTTGG - Intergenic
1183876203 22:40784216-40784238 TTTGTTCATCAAATATATATTGG - Intronic
1184317466 22:43707303-43707325 CTATTACATTACATAAATATTGG - Intronic
949090444 3:21695-21717 TTATCTCATCCCATAAATAATGG - Intergenic
949113434 3:291064-291086 ATAGTTCAAAACATTAATATAGG + Intronic
951111837 3:18812997-18813019 TTAGTTCTTGACAGAAAAATAGG - Intergenic
952008380 3:28869540-28869562 TTAGCTCAAAACATAACTATTGG - Intergenic
952260718 3:31737424-31737446 TTTCCTCAGCACATAAATATAGG + Intronic
953283466 3:41581223-41581245 CAACTTCATCACACAAATATTGG + Intronic
953520233 3:43635511-43635533 CTATTTCATCACATAGATAAAGG - Intronic
953643631 3:44732471-44732493 TTAATACATCAGATAAAGATAGG + Intronic
954243075 3:49309390-49309412 TTAATTCATCAAATATTTATTGG - Intronic
956323747 3:68027512-68027534 TGAGTTGTTCAAATAAATATCGG - Intronic
957030778 3:75237918-75237940 TTATCTCATCCCATAAATAATGG - Intergenic
957183338 3:76909999-76910021 TTAGATCTTCACAAAAATAGTGG - Intronic
957548882 3:81678019-81678041 TTTGTTCATTACTTAAAAATGGG + Intronic
957832834 3:85545499-85545521 TCAGTTCATAACATATATTTTGG - Intronic
958580588 3:96015710-96015732 GAAGTTCATCATATATATATGGG - Intergenic
959123098 3:102256294-102256316 TTATTTCCTCAAAGAAATATTGG - Intronic
959255147 3:104000981-104001003 ATATTTCATCAAATAAATCTAGG + Intergenic
959398832 3:105874538-105874560 TTAGCTGATAACATAAAGATAGG - Intergenic
959841332 3:110979502-110979524 TTAGTTCATGTCATACATTTTGG + Intergenic
963551032 3:146723073-146723095 TTAGTATATCAAAGAAATATCGG - Intergenic
963729856 3:148960774-148960796 ATATTCCATCACATAAATTTGGG + Intergenic
964015625 3:151942483-151942505 TTAGTTTTTCACCTAAAGATTGG + Intergenic
964225423 3:154394257-154394279 TTAGTTGATTATATAAATGTGGG - Intronic
965101244 3:164301104-164301126 TTAGCAAATTACATAAATATGGG + Intergenic
965203426 3:165691319-165691341 TTATTACACAACATAAATATAGG + Intergenic
965396821 3:168169694-168169716 TTAGTTAATCATATATGTATGGG + Intergenic
965748762 3:171955011-171955033 TTATTTTATCACATAAAAAAGGG - Intergenic
965800450 3:172487694-172487716 TTTGTTCATCCCATAAGTTTTGG + Intergenic
966328112 3:178779935-178779957 TTAGTTAATAAAAGAAATATAGG + Intronic
966559450 3:181303435-181303457 TTAATTCATAATATAAATTTAGG + Intergenic
966589325 3:181663216-181663238 TTAATTGATCAGATAAATAATGG - Intergenic
966987382 3:185193999-185194021 TTGGTTCTTCACATCAATTTGGG - Intronic
967557065 3:190872520-190872542 TTAGCTCTTCACTTAAAAATTGG - Intronic
967581712 3:191165521-191165543 TTAGTTCAAGACATGATTATTGG - Intergenic
968784994 4:2614393-2614415 TTAGTTAATGAAATAAATTTTGG + Intronic
969555811 4:7909014-7909036 TTAATTTATCACTTAAATATTGG - Intronic
969875372 4:10132224-10132246 GTAGTTTATCCCATAAACATAGG + Intergenic
970183548 4:13424705-13424727 TTGGTTCATAACAGAAGTATAGG - Intronic
970909593 4:21259189-21259211 GTAGTTCATACCATAAATTTTGG - Intronic
970947633 4:21713798-21713820 TTCTTTCATCACATAAACACTGG + Intronic
971520596 4:27546014-27546036 TTAGTTCAACACCTGAATTTTGG + Intergenic
971944764 4:33259964-33259986 TTAGTTTATCTCAACAATATTGG + Intergenic
973019674 4:45187098-45187120 TTTGTTGATCACATAAAAGTTGG - Intergenic
973671282 4:53220467-53220489 TTATTTCAACAAATAATTATTGG - Intronic
973726459 4:53781899-53781921 CTAATTCATCAAATAAATAACGG - Intronic
975224244 4:71851855-71851877 AAATTTCATCACATAAATTTGGG + Intergenic
975315206 4:72944267-72944289 TTGGTTGATCACAAAACTATGGG - Intergenic
975761320 4:77623323-77623345 TTAGTTCCACACATAATTAGAGG - Intergenic
975941536 4:79653465-79653487 TTTTTTCCTCATATAAATATGGG - Intergenic
976566816 4:86560666-86560688 TTACTGCATCACTTAAATAAGGG - Intronic
977478562 4:97543638-97543660 TTTGATTATCACATAAATCTAGG - Intronic
981468853 4:145106204-145106226 TTAGTTCATAAAAGAAATTTAGG + Intronic
981762065 4:148205566-148205588 TTAATTCAACAAATAATTATCGG + Intronic
981828115 4:148968102-148968124 TTAGTTTAACACACAAATACTGG - Intergenic
981985643 4:150851603-150851625 TTAGTTTATAAAACAAATATTGG - Intronic
982008013 4:151081299-151081321 TCAGTTGATCACATACACATGGG + Intergenic
982185000 4:152787368-152787390 TTGATTCATCACATAAAGTTGGG - Intronic
982656690 4:158158880-158158902 TTAGTTCACAAAATAAAAATGGG + Intronic
983371308 4:166862573-166862595 TTTGTTAAATACATAAATATTGG + Intronic
985375064 4:189326563-189326585 TTATTTCAATACATAAATATGGG + Intergenic
986214234 5:5703497-5703519 TTAATTCATTCCATAAATATGGG - Intergenic
986888731 5:12273717-12273739 TTTGTTAATCCCATCAATATTGG + Intergenic
987235287 5:15936263-15936285 TTAAATAATCAGATAAATATGGG + Intronic
989059752 5:37398415-37398437 ATAATTCATCACATAAAGAAGGG - Intronic
989290807 5:39762630-39762652 TAATTTCATCACACAAATTTGGG + Intergenic
989868014 5:46543480-46543502 TAATTTCTTCACATAAAAATTGG + Intergenic
990662749 5:58036061-58036083 ATATTTCTTCACATATATATGGG - Intergenic
992513007 5:77459124-77459146 TTATTTCTTAACATAAATTTAGG - Exonic
993299338 5:86188095-86188117 ATAGTTTTTCACCTAAATATAGG + Intergenic
993599305 5:89901062-89901084 TCAGTTCATCACATTAATGCAGG + Intergenic
993882622 5:93380895-93380917 GGATTTCATCATATAAATATTGG - Intergenic
994340333 5:98619265-98619287 TAAGTTGATCTCATAAAAATAGG + Intergenic
996597051 5:125216737-125216759 TTGTTGCATCCCATAAATATTGG - Intergenic
998858443 5:146419066-146419088 TTATTACATTACATAATTATAGG + Intergenic
1002353391 5:178602121-178602143 TAAGTGCATTACACAAATATTGG - Intergenic
1003244085 6:4369577-4369599 TTATTTCATCACATGAAGAGGGG + Intergenic
1004742754 6:18477922-18477944 TTAGTTCTTCACATACAAAATGG - Intergenic
1006764351 6:36491590-36491612 TTAGTTCCACACTTAAATGTTGG - Intergenic
1009543098 6:64990280-64990302 TTAGTTGACCATATAAAAATTGG - Intronic
1009548549 6:65055473-65055495 TTAGTTAATAACATCAATATTGG - Intronic
1009977265 6:70684727-70684749 TTACTTTATCACATAAACTTGGG - Intronic
1010347948 6:74835297-74835319 TTATTTCATCAAATACATTTTGG - Intergenic
1010595469 6:77757774-77757796 TTCATTCTTCACATAAATAAAGG - Intronic
1011903305 6:92328273-92328295 TTTTTAAATCACATAAATATAGG - Intergenic
1012113888 6:95269097-95269119 TTAATTCATTAAATAATTATAGG + Intergenic
1013356232 6:109348144-109348166 TTATTTCATCAGATAAGTAGAGG - Intergenic
1013570858 6:111424105-111424127 TTAGTGCCTCTCTTAAATATCGG - Intronic
1015711320 6:136143936-136143958 TGAGTTTATTATATAAATATAGG + Intronic
1015939930 6:138439026-138439048 TTAGTTTATCAGATAAGTTTTGG + Intronic
1016026989 6:139297738-139297760 TTATTTAAACACATAATTATTGG - Intergenic
1016494147 6:144640724-144640746 TTAATTTATAATATAAATATTGG - Intronic
1018307019 6:162468493-162468515 TTCGGTAATCCCATAAATATAGG + Intronic
1018806466 6:167265723-167265745 CTTCTTCATCACATAAAAATGGG + Intergenic
1020417689 7:7964972-7964994 TTAGTTCATAAGATAAACACTGG + Intronic
1020484273 7:8702389-8702411 CTAATTCCTCAAATAAATATCGG - Intronic
1021185449 7:17559123-17559145 TTACTTGATCCCATAAATCTTGG - Intergenic
1021387400 7:20048481-20048503 TTATTTCAGTCCATAAATATGGG + Intergenic
1023185264 7:37526499-37526521 TTATTTGATCACATAACTTTAGG - Intergenic
1024019753 7:45356781-45356803 TTATATTATCATATAAATATTGG + Intergenic
1024145927 7:46516261-46516283 ATAGTTCATCACAGAAAATTAGG + Intergenic
1025102236 7:56145200-56145222 TTAGTTAATCAAATATTTATAGG + Intergenic
1027709063 7:81574629-81574651 TTATTCCATCAAAAAAATATTGG + Intergenic
1031204284 7:118735121-118735143 TTAGTTCTTCTTTTAAATATTGG - Intergenic
1031209008 7:118797959-118797981 TTACTTCATTGCAAAAATATGGG - Intergenic
1033298948 7:140168774-140168796 TTTGTTTCTCACAAAAATATAGG + Intronic
1034297440 7:149986873-149986895 TTAGTACCTTACCTAAATATTGG - Intergenic
1034808585 7:154109981-154110003 TTAGTACCTTACCTAAATATTGG + Intronic
1037119791 8:15268837-15268859 TCACTTCATCCCATAAGTATGGG - Intergenic
1038616867 8:29103628-29103650 TTAGTTCATCAATTCAATCTTGG + Intronic
1039155276 8:34548698-34548720 TTAGTTGACCACATATATATTGG + Intergenic
1039268104 8:35850260-35850282 TTAGCACATGACATAAACATGGG - Intergenic
1039309595 8:36302021-36302043 TTAATTCATCCCACAAATAATGG + Intergenic
1041095755 8:54347821-54347843 TTAATTCTCCTCATAAATATAGG - Intergenic
1041183171 8:55270189-55270211 TTTGTGCATCAGATACATATTGG + Intronic
1042721359 8:71830233-71830255 TTAGTTCAGCACATATAAATTGG + Intronic
1043594423 8:81867093-81867115 TTAGCTCATCACAGAGATTTTGG - Intergenic
1043637302 8:82401885-82401907 TTAGTTGTTTACATAAATATTGG + Intergenic
1043720313 8:83541174-83541196 TTAGATTCTCATATAAATATAGG + Intergenic
1045009786 8:97948537-97948559 TCATTTCACCACATACATATGGG - Intronic
1046230261 8:111346786-111346808 TCAGTTTATCCCATAAGTATAGG + Intergenic
1050431823 9:5569868-5569890 TTAGTTCCTCACTCAAATTTTGG + Intronic
1051710396 9:19925303-19925325 TTTGTTCATCTCATATATATAGG + Intergenic
1051806580 9:21000129-21000151 TTAATTCATCACATACATGTAGG - Exonic
1052374215 9:27699443-27699465 TTCATTCATCATAAAAATATGGG - Intergenic
1055055903 9:72023754-72023776 AAAGTTCATCAGATAAATATAGG + Intergenic
1056179597 9:84069236-84069258 TTAGGGCATTACATAAATTTTGG + Intergenic
1057639737 9:96807260-96807282 TTAGTTGATCACATATATTTGGG - Intergenic
1058542720 9:106028759-106028781 TTTGTTCATTCCATGAATATTGG + Intergenic
1059816272 9:117919384-117919406 TTAATTCATCTCCTAAGTATTGG + Intergenic
1059882908 9:118711523-118711545 TTACTTAATCATATACATATTGG + Intergenic
1060086213 9:120704513-120704535 TTTATTCATCATATAAATATGGG + Intronic
1203408768 Un_KI270538v1:74390-74412 TAATTTCTTCACATAAAAATTGG - Intergenic
1186260542 X:7774295-7774317 TTAGATTATCCCATAAATTTTGG + Intergenic
1186616518 X:11194198-11194220 TTAGGTCATTACAAAAATAAGGG + Intronic
1186983844 X:14988946-14988968 TTAGCACATCCCACAAATATTGG + Intergenic
1188329667 X:28853607-28853629 TTATTTCCTCACACTAATATAGG - Intronic
1188434038 X:30139951-30139973 TTAGATCAGCACACAAAAATGGG + Intergenic
1188530364 X:31133605-31133627 TTACTCCATCATTTAAATATAGG - Intronic
1189527867 X:41844854-41844876 TTGCTGCATCTCATAAATATTGG + Intronic
1189671322 X:43413361-43413383 TTATTTCAACATATAAATTTGGG - Intergenic
1190513444 X:51197101-51197123 TTAGTTGATCACATATATGTGGG + Intergenic
1191165021 X:57380177-57380199 TTTGTTCATCTCTTATATATTGG + Intronic
1194376486 X:93139989-93140011 TTGTTTCATCTCATACATATTGG + Intergenic
1196375075 X:115025068-115025090 TTAGATGATCTCACAAATATAGG + Intergenic
1197606419 X:128590774-128590796 TCAGTTCATAACATGGATATAGG - Intergenic
1197815801 X:130496951-130496973 TTAGTTTATCACATAAGGACTGG - Intergenic
1197992153 X:132329832-132329854 TTAGGGCATCACAAAAATAATGG + Intergenic