ID: 945006117

View in Genome Browser
Species Human (GRCh38)
Location 2:205408867-205408889
Sequence AAATTGGGACTATTAAAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 279}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945006117_945006122 10 Left 945006117 2:205408867-205408889 CCCAGTTTTAATAGTCCCAATTT 0: 1
1: 0
2: 0
3: 26
4: 279
Right 945006122 2:205408900-205408922 GTGAACCCTGATCAGATCATGGG 0: 1
1: 0
2: 0
3: 8
4: 139
945006117_945006121 9 Left 945006117 2:205408867-205408889 CCCAGTTTTAATAGTCCCAATTT 0: 1
1: 0
2: 0
3: 26
4: 279
Right 945006121 2:205408899-205408921 AGTGAACCCTGATCAGATCATGG 0: 1
1: 1
2: 0
3: 13
4: 290
945006117_945006123 14 Left 945006117 2:205408867-205408889 CCCAGTTTTAATAGTCCCAATTT 0: 1
1: 0
2: 0
3: 26
4: 279
Right 945006123 2:205408904-205408926 ACCCTGATCAGATCATGGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945006117 Original CRISPR AAATTGGGACTATTAAAACT GGG (reversed) Intronic
900371220 1:2333030-2333052 AGAGTGGGACTATAAAAACACGG + Intronic
900762003 1:4479228-4479250 AAAGTGGGATTATTAAAAGAAGG - Intergenic
904712963 1:32444859-32444881 GAATTGGGACCATTTAATCTGGG - Intergenic
906833165 1:49056397-49056419 ACATAGGGACTTTTAAAATTAGG + Intronic
907397129 1:54198940-54198962 AAAGTGGGACTGTTAAAACGTGG - Intronic
908705050 1:66944379-66944401 ACATTGGCAGTAGTAAAACTTGG + Intronic
908705055 1:66944431-66944453 ACATTGGCAGTAGTAAAACTTGG - Intronic
909237773 1:73175594-73175616 AAATTTGGACTGTTATAACAAGG - Intergenic
909330213 1:74400402-74400424 AAATTTGGACCATTCAACCTAGG - Intronic
909856359 1:80537872-80537894 AATTTGGCACTGTTAAAAATGGG - Intergenic
910273078 1:85418337-85418359 AAAATGAGACCAATAAAACTCGG + Intronic
910742349 1:90533780-90533802 AAATTGGCAGTAGTAGAACTTGG + Intergenic
910808086 1:91208475-91208497 AAATTAGGACCATTTAATCTGGG - Intergenic
911797861 1:102096931-102096953 AAATTTTTACTTTTAAAACTGGG + Intergenic
912816013 1:112829254-112829276 AAATTGGGACCATTTAATCCAGG + Intergenic
912944514 1:114073924-114073946 ACATTGGGTCTATTATCACTTGG + Intergenic
913375377 1:118145432-118145454 AAAATGGAACTATTACATCTGGG + Intronic
913427039 1:118744624-118744646 AAGATGGCACTTTTAAAACTAGG - Intergenic
915102004 1:153507477-153507499 AAATAGGGACTATTATAGTTAGG - Intergenic
917030013 1:170679966-170679988 AAAAAGGGAAAATTAAAACTTGG - Intronic
919408482 1:197214421-197214443 AACTTGTGAATATTAAAATTGGG - Intergenic
919645435 1:200090008-200090030 AAATGGGGACTATTTGAAATGGG + Intronic
920670009 1:207996452-207996474 AAATTAGCTCTATTAAAATTAGG - Intergenic
922871371 1:228904635-228904657 AAATTGGGAAAGTTAAAAGTTGG - Intergenic
923322167 1:232845325-232845347 AAATTGGGAAGATGAAAACTTGG - Intergenic
924540769 1:244978820-244978842 AAATTGGGAGTTTAAAAACCTGG + Intronic
1065108635 10:22417467-22417489 AAAATGTGACTTTTGAAACTTGG - Exonic
1065332143 10:24613380-24613402 AAATTGGGAATATTTGAACTAGG - Intronic
1066698768 10:38104124-38104146 AAACTGGGAATGTAAAAACTGGG - Intronic
1068743400 10:60500994-60501016 AACTTGGGACTATAAGGACTTGG - Intronic
1069210533 10:65753510-65753532 AAATTGGAAATACTAAAACTTGG - Intergenic
1072134567 10:92532387-92532409 AAATTGAGCCTGTTAAAAGTAGG - Intronic
1074323731 10:112427994-112428016 GACTTGGGAGTATTAAAAATTGG + Exonic
1074542730 10:114378869-114378891 AAATTGGGATCTTCAAAACTAGG + Intronic
1075704119 10:124488872-124488894 AACTTGGGACAATCAACACTTGG - Intronic
1080124417 11:28715350-28715372 AAATTGTGATTATTCAGACTTGG - Intergenic
1081391000 11:42528718-42528740 AACTTGAGAGAATTAAAACTTGG - Intergenic
1082277635 11:50238900-50238922 ATGTTGGGATCATTAAAACTAGG - Intergenic
1085076989 11:73599942-73599964 ATAGTGGAACTATTAAAACCAGG - Intergenic
1085137567 11:74106815-74106837 AAATTTTTGCTATTAAAACTAGG + Intronic
1086973468 11:93107657-93107679 AAATTAGGACTGTTTAATCTGGG - Intergenic
1087544484 11:99566971-99566993 TAATTAGGTTTATTAAAACTAGG + Intronic
1090415574 11:126538011-126538033 AGCTTGGGACTGTTAAAACAGGG + Intronic
1090603420 11:128396007-128396029 AAATTGCGATGATTAAAATTTGG + Intergenic
1091569162 12:1669520-1669542 AGATTAGGAATATTATAACTAGG - Intergenic
1092683183 12:11011929-11011951 AAATTAGGGCTATTTCAACTTGG - Intronic
1092981995 12:13805045-13805067 AAATGGGGACAATTAAATCAAGG - Intronic
1093476436 12:19559774-19559796 AAATTGAGATTATTAAAACCTGG - Intronic
1093594123 12:20941186-20941208 AAATTGGGACCATTTAATCCAGG - Intergenic
1093731033 12:22566020-22566042 AAATTAGGTTTATTCAAACTTGG - Intergenic
1093824573 12:23667972-23667994 AAAGTGGCATTATTAAAATTGGG - Intronic
1095727205 12:45467109-45467131 AACTTGGGAAAATTAAAAGTTGG - Intergenic
1096207713 12:49737367-49737389 AAATTAGGACCATTTAATCTGGG + Intronic
1096306176 12:50479265-50479287 AAATTGGTACTTTTAAAATATGG - Exonic
1098282218 12:68873373-68873395 AAATTGGGACTAAGAAAATTTGG + Intronic
1098567022 12:71948279-71948301 GAATTGGGAGTTTTTAAACTGGG - Intronic
1098695410 12:73547369-73547391 AATTTGGAAGAATTAAAACTTGG - Intergenic
1099146290 12:79047775-79047797 AAATTGGGATTATTAAAAAATGG + Intronic
1101544581 12:105699782-105699804 AATTTGGGTATATTAAAATTAGG + Intergenic
1102439033 12:112947583-112947605 AACTTGGAACTATTACAAATAGG + Intronic
1102444512 12:112991547-112991569 AAAGTGGGACAATTCAAAGTGGG + Intronic
1102781231 12:115566642-115566664 AACTGGGGACTATTAAGAGTAGG - Intergenic
1103938262 12:124488072-124488094 AAATTGGGAAAATTAAAAAAAGG - Intronic
1106775679 13:33006678-33006700 CAAATGTGACTAATAAAACTTGG - Intergenic
1108534217 13:51356748-51356770 AAAAAGGTACTTTTAAAACTAGG - Intronic
1109132168 13:58601254-58601276 ACAGTGAGAATATTAAAACTAGG + Intergenic
1109186169 13:59271126-59271148 AAATGGGGAATTTTAAAAATTGG - Intergenic
1109588356 13:64441187-64441209 AAAATAGGACTAGAAAAACTAGG - Intergenic
1110927297 13:81169942-81169964 AAATTGGAAATATGAAAACCAGG - Intergenic
1113580875 13:111427967-111427989 AAATTGGGAATGTTAACATTTGG + Intergenic
1115323006 14:32105617-32105639 AAATTAGTACAAGTAAAACTGGG - Intronic
1115605655 14:34999339-34999361 AAATTGTGGCAATTAATACTTGG + Intronic
1120860109 14:89247345-89247367 AAATTTTGACCAATAAAACTGGG + Intronic
1124100984 15:26692860-26692882 AAATTGGAAACATTAGAACTAGG - Intronic
1124554347 15:30711143-30711165 ATATGGGGACTATTATAACATGG + Intronic
1124676898 15:31694534-31694556 ATATGGGGACTATTATAACATGG - Intronic
1130320112 15:82834356-82834378 ACATGGTGACTCTTAAAACTGGG + Exonic
1130671548 15:85917355-85917377 AAATTGGGACTTGAAAAACCAGG + Intergenic
1131203852 15:90424869-90424891 AAATTAGGAGTTTTAAATCTAGG + Intronic
1133926730 16:10199153-10199175 AAGTTAAGACAATTAAAACTTGG - Intergenic
1136565814 16:31069549-31069571 AAATTTGGAATATTAAAAGGGGG - Intronic
1137325675 16:47433434-47433456 AATTTGGGAAAATTAACACTTGG - Intronic
1139452957 16:67046487-67046509 AAATGGGAAATAGTAAAACTAGG - Intronic
1140140087 16:72247533-72247555 AAATTGGGTCCATTAATACTTGG + Intergenic
1140318245 16:73921006-73921028 AGGTTGGAATTATTAAAACTAGG + Intergenic
1146764151 17:35504211-35504233 AAATTGGGACCATTTAATCCAGG + Intronic
1148411907 17:47474772-47474794 AAATTGATATTATTCAAACTAGG + Intergenic
1148828971 17:50416856-50416878 AAATTAGGACCATTTAATCTGGG - Intergenic
1149235539 17:54586290-54586312 AATTTGGGGCTATTATAAATGGG - Intergenic
1151809176 17:76426523-76426545 AAATATGGAATTTTAAAACTAGG - Intronic
1153136350 18:1921903-1921925 AAATTGGGAGTATTATACCCAGG + Intergenic
1153653679 18:7263369-7263391 TATTTGGAACTCTTAAAACTAGG + Intergenic
1155122479 18:22836811-22836833 AAATTAGGAATATTAAAAAATGG + Intronic
1155746204 18:29358699-29358721 GAATTGGGACCATTTAATCTGGG - Intergenic
1155830255 18:30508042-30508064 GAAATAGGACTATTAAATCTAGG - Intergenic
1156766680 18:40665025-40665047 AAAATGGAATTATGAAAACTAGG - Intergenic
1157097559 18:44700167-44700189 AAATTGGGAATAATAGAACGTGG + Intronic
1158448132 18:57538926-57538948 AAATTGGGTTTATTAAATATGGG - Intergenic
1159049303 18:63403582-63403604 AAATTGTGACTGTTAAAAGGTGG - Intronic
1159398469 18:67897028-67897050 AAATCTGGACTTTTAAAAATAGG + Intergenic
1159426134 18:68289415-68289437 ACATTGGCACTAATGAAACTTGG + Intergenic
1160051038 18:75433769-75433791 TAATTGGGGCTATGCAAACTTGG - Intergenic
1163227374 19:15973885-15973907 AAAATGGTGCTATTAAAACGAGG - Intergenic
1163867095 19:19782633-19782655 AAATTAGGACTATTTAATCTGGG - Intergenic
1164121577 19:22270001-22270023 AAATTAGGACCATTTAATCTGGG - Intergenic
1164216964 19:23159023-23159045 AAATTAGGACAATTTAATCTGGG - Intergenic
1168529363 19:57115543-57115565 AAATTGGCAGTCTTAAAAATGGG + Intergenic
924961820 2:42627-42649 AAACTGAGACTATCACAACTGGG - Intronic
925650237 2:6081595-6081617 AATTTGGGGCTATTTAAATTAGG + Intergenic
926398732 2:12472725-12472747 AAGATGGGACTATTAGATCTAGG + Intergenic
926885012 2:17589115-17589137 AAATTGAGACTATTTAAAGAAGG + Intronic
928023129 2:27719553-27719575 AAATTTGCAATATCAAAACTGGG - Intergenic
929128995 2:38547358-38547380 AAAATGACCCTATTAAAACTTGG - Intergenic
929302586 2:40322735-40322757 AAATTGGTAGTGTTCAAACTTGG - Intronic
931000402 2:57773866-57773888 ACCTTGGCACTATTAAAATTTGG - Intergenic
931399012 2:61913603-61913625 AAATTGGCTCTACTAAAAATTGG + Intronic
931974561 2:67629067-67629089 AAATAGAGGTTATTAAAACTGGG + Intergenic
932948180 2:76262103-76262125 AAGTGGGAATTATTAAAACTTGG - Intergenic
933389477 2:81652146-81652168 GAATTGGGACCATTTAATCTGGG - Intergenic
935048403 2:99502517-99502539 AAATTGGGACCATTTAATCCAGG + Intergenic
935721495 2:105983251-105983273 AAATTAGGACCATTTAATCTGGG - Intergenic
935851561 2:107226648-107226670 AAAATAGGAGTATCAAAACTTGG - Intergenic
936666144 2:114598042-114598064 AAACTGGAATTATTAAAAATTGG + Intronic
937122839 2:119452663-119452685 AAATTTGGACTATAGACACTTGG + Intronic
938703154 2:133897361-133897383 AAATTGGGACCATTTAATCTGGG + Intergenic
940024937 2:149196167-149196189 AAATTGCCACTATTACCACTTGG - Intronic
940069250 2:149666462-149666484 AAACTGGGACTATTAATATATGG - Intergenic
940238479 2:151536750-151536772 AAAATGAGGCTATAAAAACTAGG + Intronic
940478483 2:154196716-154196738 ATATTGTGACTATTGAAACATGG - Intronic
943305324 2:186254668-186254690 GAATTGATACTATTAAATCTTGG - Intergenic
943408078 2:187513974-187513996 AAATTGGGACCATTTAATCCAGG + Intronic
944288975 2:197982975-197982997 AAATTGGTAATAATAAAAATTGG + Intronic
945006117 2:205408867-205408889 AAATTGGGACTATTAAAACTGGG - Intronic
945289732 2:208115388-208115410 AAATTAGGACCATTTAATCTGGG + Intergenic
945373937 2:209056770-209056792 AAATTTGGAATATTAATATTTGG + Intergenic
945479240 2:210324928-210324950 AAATTGGGACCAGTAAAGCCGGG + Intergenic
1169527182 20:6441868-6441890 AAATAGGGATTATAATAACTTGG - Intergenic
1173619640 20:44427015-44427037 ACATTGGTACTATTGATACTTGG + Intronic
1174663052 20:52232027-52232049 AAAATGTTACTATTGAAACTAGG - Intergenic
1174988961 20:55487887-55487909 ATATTGGGAATTTTAGAACTAGG + Intergenic
1177335408 21:19718929-19718951 AAATTGGGACCAGTAAAACCTGG - Intergenic
1177347535 21:19892581-19892603 AAATTGGAATTAAAAAAACTTGG - Intergenic
1182033864 22:27182127-27182149 AAATAGCGACTATAAAAAGTGGG + Intergenic
1182720888 22:32398894-32398916 AAACTGGGATGGTTAAAACTAGG - Intronic
949610953 3:5702899-5702921 AAATTGGGACCATTTAATCCGGG - Intergenic
952468848 3:33622750-33622772 AATTTGGCACTTTTAAAAATAGG - Intronic
952690937 3:36204814-36204836 AAATAGTGATTATTAACACTTGG + Intergenic
953078282 3:39591794-39591816 AAAGTGGCAATATTAAAACTAGG - Intergenic
956178692 3:66499059-66499081 AAATGCGGACTATTTAAGCTAGG + Intronic
956260985 3:67341206-67341228 AAATTGTTGATATTAAAACTTGG - Intergenic
956990857 3:74763023-74763045 AATTTGGGACTATTATAATGAGG - Intergenic
957323335 3:78660247-78660269 AGTTTGGGACTATTCAGACTTGG - Intronic
957347028 3:78974845-78974867 AAATAGGGACTTTTAAATTTGGG - Intronic
957938199 3:86970583-86970605 AAATTGAGACTATTGAAATGAGG + Intronic
958518429 3:95152852-95152874 AAATTGGGACAATAAAATATGGG + Intergenic
959460911 3:106624248-106624270 AAATTAGGACTTTTAAAGCCTGG + Intergenic
960215987 3:115037608-115037630 TAATTTGGACTTTCAAAACTGGG + Intronic
960274468 3:115712424-115712446 CTCTTGAGACTATTAAAACTTGG + Intronic
962450580 3:135513177-135513199 AAATTTTTACTTTTAAAACTGGG + Intergenic
962612647 3:137092874-137092896 AAATTGTGACTGTTAAGTCTGGG - Intergenic
964970192 3:162551000-162551022 AAAATGGGACCATTAATGCTGGG - Intergenic
967672027 3:192247924-192247946 AAATTAGGACTTTTTAAATTGGG + Intronic
970844502 4:20520340-20520362 AAAATGCAAATATTAAAACTTGG + Intronic
972473175 4:39426447-39426469 AAATTTGGACCATTAAAAATAGG + Intronic
972521032 4:39856992-39857014 AATTTGCTACTATTCAAACTAGG + Intronic
972784977 4:42318341-42318363 GAATTGGGACCATTTAATCTGGG + Intergenic
974639803 4:64613538-64613560 AAATTATAACTATTATAACTTGG + Intergenic
976305803 4:83558309-83558331 AAAATGGGATTAAAAAAACTGGG + Intronic
976310197 4:83604031-83604053 AAACAAGGATTATTAAAACTAGG - Intronic
976557814 4:86468989-86469011 AAAGTGGGAATGTTAAATCTGGG + Intronic
977728965 4:100329445-100329467 AAATTAGGACAATTAAAAGCAGG - Intergenic
977972369 4:103227293-103227315 AAATTAGGACCATTTAATCTGGG + Intergenic
978363015 4:107950750-107950772 AAAATGAGAGTAATAAAACTTGG + Exonic
979486736 4:121278878-121278900 AACTTCACACTATTAAAACTGGG - Intergenic
979886041 4:126029611-126029633 AAATTGTGATTTTTAAAATTAGG + Intergenic
980938371 4:139248066-139248088 AAATTGTTGCAATTAAAACTGGG - Intergenic
982020861 4:151202884-151202906 ATATTCTGACCATTAAAACTGGG + Intronic
982200150 4:152952362-152952384 AAATTGGGGCTTTTAAATGTGGG + Intronic
982301842 4:153887030-153887052 AATTTGGGATTATTAGCACTGGG + Intergenic
983186291 4:164704851-164704873 CAACTGGGCCTATTAAAAATAGG - Intergenic
984387104 4:179074755-179074777 TAACTGGGAGTATTAGAACTGGG + Intergenic
984676500 4:182554295-182554317 AAAGTTGGAATATTTAAACTGGG - Intronic
984734246 4:183096266-183096288 AAATTGGTAATATCAAAAATGGG - Intergenic
984741020 4:183163116-183163138 AAACTGGAACTATTAAAAAGTGG + Intronic
985426640 4:189837858-189837880 CATTTGGAAATATTAAAACTAGG + Intergenic
986627869 5:9739443-9739465 AAAATGGAATTAATAAAACTGGG + Intergenic
987985721 5:25142883-25142905 AAATTGAGACTAATTAAAATGGG - Intergenic
990489046 5:56286071-56286093 TAATTGGGACCAAGAAAACTTGG + Intergenic
991082400 5:62615296-62615318 AACTTGGGACTATCAAACATTGG - Intronic
991262725 5:64684458-64684480 AAACAGTGACTATTAAAAGTAGG + Intergenic
991720497 5:69491257-69491279 AAATTGGTATTGTTAACACTGGG - Intergenic
991941282 5:71854580-71854602 AAATTGGTACTACAAAGACTAGG - Intergenic
992968141 5:82024922-82024944 AAATTGAGATTTTAAAAACTGGG + Intronic
993171199 5:84421131-84421153 AAATTGGGTCAAATAAAAATGGG + Intergenic
993301482 5:86216305-86216327 AAATTGGGGGTATTTATACTAGG - Intergenic
994374762 5:99006613-99006635 AAATTAGGATTATTCAGACTTGG + Intergenic
995533426 5:113112829-113112851 AACTTGGGACTTTAAAAAGTTGG - Intronic
995549136 5:113263492-113263514 AAATTGGTACCATTAAAACATGG + Intronic
997292731 5:132748927-132748949 AAATTGAGCCTTTTAAAAATGGG + Intronic
998552492 5:143090864-143090886 GAATTGGGACCATTTAATCTGGG - Intronic
998772166 5:145558160-145558182 TTAATGGGACTATTAAAACCTGG + Intronic
999115143 5:149156164-149156186 AAACTGGTACTTTGAAAACTAGG + Intronic
999856354 5:155598991-155599013 GAATTGTGACTATTAACATTTGG - Intergenic
999896004 5:156034066-156034088 AGAGAGGGACTATTAAAAATTGG - Intronic
1000236817 5:159369717-159369739 AAATTAGGACCATTTAATCTGGG + Intergenic
1000429640 5:161135951-161135973 AAATTGGGAGTTTCAAAACTAGG + Intergenic
1000681088 5:164185609-164185631 AAATTAGGACTGTCACAACTTGG + Intergenic
1000775150 5:165410433-165410455 AAATTGAGACTAGTTAAAATGGG - Intergenic
1001035553 5:168293718-168293740 ATATTGGGATGCTTAAAACTTGG + Intronic
1001304978 5:170565699-170565721 AAACTAGGATTTTTAAAACTAGG + Intronic
1001558448 5:172652648-172652670 AAATTAGGACCATTTAATCTGGG - Intronic
1003974001 6:11325821-11325843 AAATTGGGTCTATGTAGACTGGG - Intronic
1004385099 6:15165860-15165882 GAATTGGGACCATAAAAAGTGGG - Intergenic
1007895521 6:45352563-45352585 AGATTGGGACTATTTATCCTAGG + Intronic
1008083983 6:47224404-47224426 AAATTGGGACTCTTCATTCTGGG + Intergenic
1008182553 6:48350149-48350171 AGTTTGGGACTATTATAAATAGG + Intergenic
1009866360 6:69402501-69402523 AAAATGGGAGTATTAAATGTGGG - Intergenic
1011396268 6:86912137-86912159 AAATTGGGACTATTAGAATGGGG + Intergenic
1013873407 6:114795621-114795643 AAATTTGGATTCTTAAAATTAGG + Intergenic
1014091054 6:117403931-117403953 AATTTGGCACTTTTAAAAATTGG + Intronic
1014817946 6:125955551-125955573 AAATTGTGAATACTAAAATTTGG + Intergenic
1015720181 6:136233517-136233539 AAATTGAATTTATTAAAACTTGG + Intronic
1016329206 6:142938703-142938725 AAGGTGGGACTTTTGAAACTAGG - Intronic
1016704643 6:147092267-147092289 AAATTGGGACAAGTATGACTTGG + Intergenic
1017639608 6:156479188-156479210 AAAATGAGAATATCAAAACTGGG + Intergenic
1017932716 6:158973359-158973381 AAATTGGTACCATTAACATTTGG + Intronic
1018300648 6:162399015-162399037 AAAATGGGACTATGAAAAATGGG + Intronic
1020655777 7:10926749-10926771 AAATTGGGACCATTTAATCTGGG + Intergenic
1020705185 7:11535370-11535392 TATTTTGGACTATAAAAACTTGG - Intronic
1022196885 7:28077168-28077190 AAATCGGAACTATACAAACTGGG + Intronic
1023799497 7:43821659-43821681 GAATTGGGACCATTTAATCTGGG + Intergenic
1024788223 7:52932542-52932564 AAATTGGCTCTTTTTAAACTGGG - Intergenic
1025156638 7:56613074-56613096 AAATTTGGACTCTCATAACTAGG - Intergenic
1026951751 7:74352125-74352147 GTATTGAGACTATTAAAACTAGG + Intronic
1027336630 7:77157788-77157810 AAATTGGTGCTATGATAACTTGG - Intronic
1027635715 7:80670160-80670182 AAATTTGTACTATTAAAAATTGG - Intronic
1027730279 7:81862737-81862759 ATATTGGGATAATTAAACCTGGG - Intergenic
1028243978 7:88453857-88453879 AAATTGGAAGTTTTAAATCTTGG - Intergenic
1030205180 7:106945500-106945522 AAATGGGAAATATTTAAACTGGG - Intergenic
1031407517 7:121404456-121404478 AAATCAGTGCTATTAAAACTGGG + Intergenic
1031764263 7:125757247-125757269 AAATTGAGACAAATAAAAATGGG - Intergenic
1032170546 7:129581078-129581100 AAATTGGGACCATTTAATCTGGG + Intergenic
1033097551 7:138443939-138443961 GAATTGGGACCATTTAATCTGGG - Intergenic
1033815874 7:145072008-145072030 AATTTGGGGCTTTTAAAATTAGG + Intergenic
1034325054 7:150222121-150222143 AAATGGGGATTATTCCAACTTGG - Intergenic
1034724910 7:153326479-153326501 AAATTGAATCTATTAAAAATTGG - Intergenic
1036074248 8:5476953-5476975 AAATTGGGATTATCTAAACTGGG + Intergenic
1036080499 8:5550091-5550113 AACTTGGCACTATTAAATTTTGG + Intergenic
1036332204 8:7838352-7838374 AAGGTGGGACTATTCAAAGTGGG - Intronic
1037017906 8:13931459-13931481 AGACTGGGACAATTGAAACTAGG - Intergenic
1038249952 8:25894040-25894062 ATATTTGGAATATTAAAACCTGG - Intronic
1038810719 8:30839458-30839480 AAAAAGGGACTTTTAAAAATAGG - Intronic
1038824804 8:30988916-30988938 AACTTGGGACCCTGAAAACTGGG + Intergenic
1040357898 8:46637430-46637452 ATATTGTGACTCTTATAACTAGG + Intergenic
1040358472 8:46642254-46642276 AAATTTTGACTCTTATAACTAGG + Intergenic
1040379148 8:46855455-46855477 AAATTTTGACTCTTATAACTAGG + Intergenic
1040978706 8:53222600-53222622 AGATTGGGAGAATAAAAACTAGG - Intergenic
1042148325 8:65755469-65755491 AAATTGGTATTATTCAAACTAGG - Intronic
1042408586 8:68435325-68435347 AAATAGGGTTTATTAAAAATGGG + Intronic
1043328206 8:79079579-79079601 AAATTGGGACTACAAAACATTGG - Intergenic
1043768632 8:84169019-84169041 AAATGGGGATAATTAACACTGGG - Intergenic
1045623486 8:104011806-104011828 AGATTGGTACTCTTAAAAATAGG + Intronic
1046395741 8:113635991-113636013 AGATTGGGTCTATAAAAATTAGG - Intergenic
1048051363 8:130820163-130820185 AAATAGATAATATTAAAACTTGG - Intronic
1053023423 9:34711032-34711054 AAGTTGGTATTATTCAAACTAGG - Intergenic
1053110750 9:35457664-35457686 AAATTGGGACCATTTAATCCAGG - Intergenic
1055106832 9:72522076-72522098 AAACTGGGACTATCCTAACTGGG - Intronic
1055835915 9:80441662-80441684 AATTTGGCACTATTAAAATTCGG - Intergenic
1056712616 9:89002933-89002955 GAATTTGAACTTTTAAAACTTGG - Exonic
1057106079 9:92418467-92418489 AAACTGGGACTCTTAAAAGATGG - Intronic
1057677119 9:97144512-97144534 TAATTGGAAATGTTAAAACTGGG - Intergenic
1060792415 9:126495474-126495496 TACTTGTGACTATTAAAAGTAGG - Intronic
1186573535 X:10741150-10741172 AACCTTGGACTATTAAAGCTAGG + Intronic
1187853689 X:23616266-23616288 CAATGGGGACTATTAGAAGTAGG + Intergenic
1188069794 X:25704872-25704894 AAATTGGTACCATGAAAAGTGGG + Intergenic
1188566856 X:31536348-31536370 AATTCGGGACTGTTTAAACTGGG + Intronic
1188671452 X:32887035-32887057 CAATTGGGAATATTAATAATTGG + Intronic
1191917985 X:66222700-66222722 AAATTAGGACCATTTAATCTGGG - Intronic
1192569469 X:72191015-72191037 GGATTGGGACTACTAATACTTGG + Intronic
1192859417 X:75050262-75050284 AATTTGGGATTGTAAAAACTGGG - Intergenic
1193422382 X:81296863-81296885 AAATTGAGAATATAAAAACATGG - Intronic
1193717323 X:84948305-84948327 AAATTAGGACCATTTAATCTGGG + Intergenic
1193970939 X:88051848-88051870 AAGTTGGTATTATTGAAACTAGG + Intergenic
1194035716 X:88868894-88868916 AAATTCGCAGTATTAAAATTTGG - Intergenic
1194945986 X:100068116-100068138 AAATTGACATTAATAAAACTTGG + Intergenic
1195616050 X:106912727-106912749 AAATTGTGGTTATTCAAACTTGG + Intronic
1196460062 X:115920392-115920414 AAATTAGGACCATTTAATCTGGG + Intergenic
1196813402 X:119646124-119646146 AAATGGGGACTAACATAACTGGG - Intronic
1197447922 X:126574706-126574728 AAATTGTGGCTGTTAAAACTAGG - Intergenic
1197450873 X:126615799-126615821 AAATTATGAGTATGAAAACTAGG + Intergenic
1198009113 X:132532342-132532364 AAAATGGGCATAATAAAACTTGG + Intergenic
1198742465 X:139855810-139855832 AAATTGGGACCATTTAATCTGGG + Intronic
1199278610 X:145974194-145974216 GAATTGGGACCATTTAATCTGGG + Intergenic
1199638347 X:149835094-149835116 AAATTAGGACCATTTAATCTGGG + Intergenic
1200730397 Y:6730919-6730941 AAATTGGAGATTTTAAAACTGGG - Intergenic
1200859554 Y:7975896-7975918 AAATTTTGACTCTTACAACTAGG - Intergenic
1200890757 Y:8321468-8321490 AAATTTTGACTAGTATAACTAGG + Intergenic
1202259710 Y:22957722-22957744 AAATTTTGACTCTTACAACTAGG + Intergenic
1202262358 Y:22982998-22983020 AAATTTTGACTTTTATAACTAGG + Intronic
1202264999 Y:23008745-23008767 AAATTGGGGTTATGATAACTGGG - Intergenic
1202412696 Y:24591466-24591488 AAATTTTGACTCTTACAACTAGG + Intergenic
1202415348 Y:24616739-24616761 AAATTTTGACTTTTATAACTAGG + Intronic
1202417990 Y:24642487-24642509 AAATTGGGGTTATGATAACTGGG - Intergenic
1202452796 Y:25027599-25027621 AAATTGGGGTTATGATAACTGGG + Intergenic
1202455439 Y:25053347-25053369 AAATTTTGACTTTTATAACTAGG - Intronic
1202458084 Y:25078604-25078626 AAATTTTGACTCTTACAACTAGG - Intergenic